\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819848991:

Variant ID: vg0819848991 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19848991
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCGGTTTATGCTGAACACAATCTTAGGCTGCGTTTGGCAAACCAGCTTCCTAACTCCTCCTACTCGTTTTCCGCGCGCACGTTTTTCAAACTGCTAAAC[A/G]
GTACGTTTTTTTACAAAAAGTTTCTATAAGAAAGTTGCTTAAAAAAATCAAATTAATCCTTTTTTTAAAAAAAATAGCAAATACTTAATTAATCACGCTC

Reverse complement sequence

GAGCGTGATTAATTAAGTATTTGCTATTTTTTTTAAAAAAAGGATTAATTTGATTTTTTTAAGCAACTTTCTTATAGAAACTTTTTGTAAAAAAACGTAC[T/C]
GTTTAGCAGTTTGAAAAACGTGCGCGCGGAAAACGAGTAGGAGGAGTTAGGAAGCTGGTTTGCCAAACGCAGCCTAAGATTGTGTTCAGCATAAACCGAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.90% 26.00% 0.55% 14.62% NA
All Indica  2759 64.00% 11.40% 0.87% 23.78% NA
All Japonica  1512 64.20% 35.60% 0.07% 0.20% NA
Aus  269 0.70% 98.10% 0.00% 1.12% NA
Indica I  595 80.20% 17.10% 0.00% 2.69% NA
Indica II  465 82.40% 2.80% 0.22% 14.62% NA
Indica III  913 49.50% 6.90% 1.64% 41.95% NA
Indica Intermediate  786 57.60% 17.30% 1.02% 24.05% NA
Temperate Japonica  767 85.10% 14.90% 0.00% 0.00% NA
Tropical Japonica  504 28.80% 71.00% 0.00% 0.20% NA
Japonica Intermediate  241 71.40% 27.40% 0.41% 0.83% NA
VI/Aromatic  96 6.20% 72.90% 0.00% 20.83% NA
Intermediate  90 43.30% 45.60% 1.11% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819848991 A -> G LOC_Os08g32000.1 upstream_gene_variant ; 3097.0bp to feature; MODIFIER silent_mutation Average:64.068; most accessible tissue: Zhenshan97 panicle, score: 87.451 N N N N
vg0819848991 A -> G LOC_Os08g31990-LOC_Os08g32000 intergenic_region ; MODIFIER silent_mutation Average:64.068; most accessible tissue: Zhenshan97 panicle, score: 87.451 N N N N
vg0819848991 A -> DEL N N silent_mutation Average:64.068; most accessible tissue: Zhenshan97 panicle, score: 87.451 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819848991 NA 2.06E-19 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0819848991 NA 4.12E-07 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819848991 NA 2.05E-08 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819848991 NA 6.51E-09 mr1608 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819848991 NA 7.81E-06 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819848991 NA 1.24E-08 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819848991 NA 7.36E-06 mr1976 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819848991 NA 9.42E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819848991 NA 5.71E-06 mr1133_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819848991 NA 5.94E-07 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819848991 NA 4.11E-06 mr1282_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819848991 NA 1.68E-06 mr1299_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819848991 NA 4.07E-10 mr1319_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819848991 3.79E-06 3.79E-06 mr1412_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819848991 1.31E-06 2.10E-07 mr1467_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819848991 2.73E-06 2.72E-06 mr1485_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819848991 3.09E-06 3.09E-06 mr1488_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819848991 NA 9.34E-06 mr1554_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819848991 NA 8.16E-06 mr1556_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819848991 NA 8.09E-07 mr1566_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819848991 NA 2.79E-07 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819848991 NA 3.33E-06 mr1667_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819848991 NA 6.45E-06 mr1700_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819848991 4.31E-06 4.31E-06 mr1753_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819848991 NA 1.21E-06 mr1756_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819848991 NA 4.78E-07 mr1759_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819848991 NA 1.74E-14 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819848991 NA 5.68E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819848991 NA 3.01E-06 mr1811_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819848991 7.29E-07 6.81E-09 mr1823_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819848991 NA 3.44E-07 mr1824_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819848991 3.83E-06 3.21E-07 mr1831_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819848991 NA 4.55E-06 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819848991 NA 1.41E-07 mr1856_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819848991 NA 7.07E-06 mr1985_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251