\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819829527:

Variant ID: vg0819829527 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19829527
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, A: 0.03, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


GGTATTGTCTCCATGTTGCTATCTGCTGTAGTAGCGCCTAACTAAAAAACCTATCGTGTCAGTATATTCTGCTCTATCGAATGTAAGTACAATAACTAGA[A/T]
CTGATATGTGCTCGTCTTAAGTGGTGATGTCATGTATAAGTGTGATCAGGGTATGGTAAGCTCATGTAATGATTGTTACTGCTGCTATTCTCGTGTCAAA

Reverse complement sequence

TTTGACACGAGAATAGCAGCAGTAACAATCATTACATGAGCTTACCATACCCTGATCACACTTATACATGACATCACCACTTAAGACGAGCACATATCAG[T/A]
TCTAGTTATTGTACTTACATTCGATAGAGCAGAATATACTGACACGATAGGTTTTTTAGTTAGGCGCTACTACAGCAGATAGCAACATGGAGACAATACC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.00% 19.50% 0.28% 24.16% NA
All Indica  2759 61.00% 1.70% 0.36% 36.90% NA
All Japonica  1512 36.10% 56.20% 0.13% 7.54% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 42.50% 2.00% 0.34% 55.13% NA
Indica II  465 22.40% 2.80% 0.65% 74.19% NA
Indica III  913 90.60% 0.50% 0.00% 8.87% NA
Indica Intermediate  786 63.50% 2.30% 0.64% 33.59% NA
Temperate Japonica  767 15.10% 84.50% 0.00% 0.39% NA
Tropical Japonica  504 71.40% 9.30% 0.20% 19.05% NA
Japonica Intermediate  241 29.00% 64.30% 0.41% 6.22% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 67.80% 20.00% 1.11% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819829527 A -> T LOC_Os08g31970.1 3_prime_UTR_variant ; 133.0bp to feature; MODIFIER silent_mutation Average:80.539; most accessible tissue: Callus, score: 95.694 N N N N
vg0819829527 A -> T LOC_Os08g31970.2 3_prime_UTR_variant ; 572.0bp to feature; MODIFIER silent_mutation Average:80.539; most accessible tissue: Callus, score: 95.694 N N N N
vg0819829527 A -> T LOC_Os08g31960.1 downstream_gene_variant ; 3139.0bp to feature; MODIFIER silent_mutation Average:80.539; most accessible tissue: Callus, score: 95.694 N N N N
vg0819829527 A -> T LOC_Os08g31980.1 downstream_gene_variant ; 801.0bp to feature; MODIFIER silent_mutation Average:80.539; most accessible tissue: Callus, score: 95.694 N N N N
vg0819829527 A -> DEL N N silent_mutation Average:80.539; most accessible tissue: Callus, score: 95.694 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0819829527 A T -0.01 -0.01 -0.02 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819829527 NA 6.43E-14 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819829527 NA 3.56E-06 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819829527 NA 5.03E-13 mr1282 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819829527 NA 4.63E-06 mr1282 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819829527 NA 2.90E-07 mr1364 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819829527 NA 2.80E-08 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819829527 NA 4.94E-07 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819829527 NA 9.20E-14 mr1650 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819829527 NA 8.64E-12 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819829527 NA 1.76E-10 mr1790 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819829527 NA 5.96E-07 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819829527 NA 3.29E-09 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819829527 NA 9.79E-16 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819829527 3.28E-07 1.33E-17 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819829527 NA 2.67E-08 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819829527 NA 3.14E-13 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819829527 2.74E-06 2.61E-14 mr1282_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819829527 NA 7.90E-07 mr1282_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819829527 NA 1.25E-07 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819829527 NA 1.70E-09 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819829527 NA 3.85E-08 mr1606_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819829527 NA 2.38E-07 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819829527 NA 8.54E-14 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819829527 NA 8.11E-10 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819829527 NA 2.05E-11 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819829527 NA 5.43E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819829527 NA 1.37E-19 mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819829527 NA 2.78E-11 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819829527 NA 1.89E-11 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251