\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819793460:

Variant ID: vg0819793460 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19793460
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTATCGTTTATACTTCATAGTTAACAACCAAATCTGACAAACAAATTAAACTATATGATAAAAAATGGTAACAAATATTTAAAAATGGAAATAAGGAGT[A/T]
GACAACAACAACTACATAGTAGCAATACGAGCTGAATTGTTGATGCACAGTTGTCGTGTATATTGGAAGTATATATTCATGTTTTTTTTAAAAAAACATA

Reverse complement sequence

TATGTTTTTTTAAAAAAAACATGAATATATACTTCCAATATACACGACAACTGTGCATCAACAATTCAGCTCGTATTGCTACTATGTAGTTGTTGTTGTC[T/A]
ACTCCTTATTTCCATTTTTAAATATTTGTTACCATTTTTTATCATATAGTTTAATTTGTTTGTCAGATTTGGTTGTTAACTATGAAGTATAAACGATAGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.60% 26.20% 0.23% 0.00% NA
All Indica  2759 66.50% 33.20% 0.33% 0.00% NA
All Japonica  1512 99.10% 0.70% 0.13% 0.00% NA
Aus  269 16.00% 84.00% 0.00% 0.00% NA
Indica I  595 60.80% 38.70% 0.50% 0.00% NA
Indica II  465 93.50% 6.50% 0.00% 0.00% NA
Indica III  913 56.20% 43.70% 0.11% 0.00% NA
Indica Intermediate  786 66.70% 32.70% 0.64% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 96.70% 2.50% 0.83% 0.00% NA
VI/Aromatic  96 41.70% 58.30% 0.00% 0.00% NA
Intermediate  90 70.00% 30.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819793460 A -> T LOC_Os08g31920.1 upstream_gene_variant ; 3921.0bp to feature; MODIFIER silent_mutation Average:46.115; most accessible tissue: Callus, score: 89.815 N N N N
vg0819793460 A -> T LOC_Os08g31930.1 upstream_gene_variant ; 2989.0bp to feature; MODIFIER silent_mutation Average:46.115; most accessible tissue: Callus, score: 89.815 N N N N
vg0819793460 A -> T LOC_Os08g31920-LOC_Os08g31930 intergenic_region ; MODIFIER silent_mutation Average:46.115; most accessible tissue: Callus, score: 89.815 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819793460 3.11E-06 2.64E-22 Plant_height All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0819793460 1.89E-06 1.79E-17 Plant_height Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0819793460 NA 1.55E-08 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819793460 NA 4.46E-07 mr1192 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819793460 NA 4.57E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819793460 NA 5.76E-06 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819793460 NA 2.72E-06 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819793460 NA 1.03E-08 mr1327_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819793460 NA 1.96E-06 mr1359_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819793460 NA 1.96E-07 mr1511_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819793460 NA 8.14E-09 mr1566_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819793460 NA 2.03E-08 mr1566_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819793460 NA 6.85E-06 mr1609_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819793460 NA 1.34E-06 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819793460 NA 9.65E-10 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819793460 NA 1.20E-07 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819793460 NA 5.90E-06 mr1735_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819793460 NA 1.39E-06 mr1743_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819793460 NA 4.43E-07 mr1759_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819793460 NA 7.00E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251