Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819793460:

Variant ID: vg0819793460 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 19793460
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCTATCGTTTATACTTCATAGTTAACAACCAAATCTGACAAACAAATTAAACTATATGATAAAAAATGGTAACAAATATTTAAAAATGGAAATAAGGAGT[A/T]
GACAACAACAACTACATAGTAGCAATACGAGCTGAATTGTTGATGCACAGTTGTCGTGTATATTGGAAGTATATATTCATGTTTTTTTTAAAAAAACATA

Reverse complement sequence

TATGTTTTTTTAAAAAAAACATGAATATATACTTCCAATATACACGACAACTGTGCATCAACAATTCAGCTCGTATTGCTACTATGTAGTTGTTGTTGTC[T/A]
ACTCCTTATTTCCATTTTTAAATATTTGTTACCATTTTTTATCATATAGTTTAATTTGTTTGTCAGATTTGGTTGTTAACTATGAAGTATAAACGATAGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.60%	26.20%	0.23%	0.00%	NA
All Indica	2759	66.50%	33.20%	0.33%	0.00%	NA
All Japonica	1512	99.10%	0.70%	0.13%	0.00%	NA
Aus	269	16.00%	84.00%	0.00%	0.00%	NA
Indica I	595	60.80%	38.70%	0.50%	0.00%	NA
Indica II	465	93.50%	6.50%	0.00%	0.00%	NA
Indica III	913	56.20%	43.70%	0.11%	0.00%	NA
Indica Intermediate	786	66.70%	32.70%	0.64%	0.00%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	96.70%	2.50%	0.83%	0.00%	NA
VI/Aromatic	96	41.70%	58.30%	0.00%	0.00%	NA
Intermediate	90	70.00%	30.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0819793460	A -> T	LOC_Os08g31920.1	upstream_gene_variant ; 3921.0bp to feature; MODIFIER	silent_mutation	Average:46.115; most accessible tissue: Callus, score: 89.815	N	N	N	N
vg0819793460	A -> T	LOC_Os08g31930.1	upstream_gene_variant ; 2989.0bp to feature; MODIFIER	silent_mutation	Average:46.115; most accessible tissue: Callus, score: 89.815	N	N	N	N
vg0819793460	A -> T	LOC_Os08g31920-LOC_Os08g31930	intergenic_region ; MODIFIER	silent_mutation	Average:46.115; most accessible tissue: Callus, score: 89.815	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0819793460	3.11E-06	2.64E-22	Plant_height	All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0819793460	1.89E-06	1.79E-17	Plant_height	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0819793460	NA	1.55E-08	mr1192	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819793460	NA	4.46E-07	mr1192	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819793460	NA	4.57E-06	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819793460	NA	5.76E-06	mr1627	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819793460	NA	2.72E-06	mr1115_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819793460	NA	1.03E-08	mr1327_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819793460	NA	1.96E-06	mr1359_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819793460	NA	1.96E-07	mr1511_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819793460	NA	8.14E-09	mr1566_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819793460	NA	2.03E-08	mr1566_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819793460	NA	6.85E-06	mr1609_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819793460	NA	1.34E-06	mr1611_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819793460	NA	9.65E-10	mr1627_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819793460	NA	1.20E-07	mr1653_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819793460	NA	5.90E-06	mr1735_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819793460	NA	1.39E-06	mr1743_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819793460	NA	4.43E-07	mr1759_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819793460	NA	7.00E-06	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251