Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819769034:

Variant ID: vg0819769034 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 19769034
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.57, C: 0.43, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

GGGCGCCTGATGGCAGAGGAAAAATCGGACGCCTCGGGCTTTCTTTCGCTATTTGCTGAAACATTATTTTTATAAAAGGTGAAACAACACCCGATTTAAA[T/C]
GAGTGAAACATTTTTGATCTATTTAGTGAAACAATTCCGATATACCTGGTGGAACATCGTGCAACATTTAAAAATAATTCAATAATAAGCTAAAAAAATT

Reverse complement sequence

AATTTTTTTAGCTTATTATTGAATTATTTTTAAATGTTGCACGATGTTCCACCAGGTATATCGGAATTGTTTCACTAAATAGATCAAAAATGTTTCACTC[A/G]
TTTAAATCGGGTGTTGTTTCACCTTTTATAAAAATAATGTTTCAGCAAATAGCGAAAGAAAGCCCGAGGCGTCCGATTTTTCCTCTGCCATCAGGCGCCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	19.00%	17.80%	0.78%	62.46%	NA
All Indica	2759	26.90%	1.30%	0.83%	70.93%	NA
All Japonica	1512	6.30%	51.70%	0.86%	41.20%	NA
Aus	269	8.90%	0.70%	0.37%	89.96%	NA
Indica I	595	2.90%	2.00%	0.84%	94.29%	NA
Indica II	465	16.30%	1.70%	0.65%	81.29%	NA
Indica III	913	46.00%	0.70%	0.33%	53.01%	NA
Indica Intermediate	786	29.10%	1.40%	1.53%	67.94%	NA
Temperate Japonica	767	5.20%	76.50%	0.52%	17.73%	NA
Tropical Japonica	504	3.60%	9.30%	1.59%	85.52%	NA
Japonica Intermediate	241	15.40%	61.00%	0.41%	23.24%	NA
VI/Aromatic	96	21.90%	4.20%	0.00%	73.96%	NA
Intermediate	90	16.70%	17.80%	0.00%	65.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0819769034	T -> C	LOC_Os08g31880.1	upstream_gene_variant ; 4807.0bp to feature; MODIFIER	silent_mutation	Average:33.626; most accessible tissue: Minghui63 root, score: 47.894	N	N	N	N
vg0819769034	T -> C	LOC_Os08g31890.1	upstream_gene_variant ; 1621.0bp to feature; MODIFIER	silent_mutation	Average:33.626; most accessible tissue: Minghui63 root, score: 47.894	N	N	N	N
vg0819769034	T -> C	LOC_Os08g31900.1	downstream_gene_variant ; 1506.0bp to feature; MODIFIER	silent_mutation	Average:33.626; most accessible tissue: Minghui63 root, score: 47.894	N	N	N	N
vg0819769034	T -> C	LOC_Os08g31890-LOC_Os08g31900	intergenic_region ; MODIFIER	silent_mutation	Average:33.626; most accessible tissue: Minghui63 root, score: 47.894	N	N	N	N
vg0819769034	T -> DEL	N	N	silent_mutation	Average:33.626; most accessible tissue: Minghui63 root, score: 47.894	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0819769034	4.54E-07	4.97E-08	mr1422	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251