Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819679743:

Variant ID: vg0819679743 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19679743
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.95, G: 0.05, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


CATCCTACCCTATGAATTATATTAACCCCTACTTAGACTATGATTATTACAAGTAACATATAAATTATTAGTACGGTTCTCTCTACTATAATCTTCCCAC[A/G]
GGATTAAACAAATATGATACCCTTGAAATACTCTCAGGTGAAATACTACAATGGTATATACGTGCGCTTGCGGATAAACTCTGTATCCATAATATACCAG

Reverse complement sequence

CTGGTATATTATGGATACAGAGTTTATCCGCAAGCGCACGTATATACCATTGTAGTATTTCACCTGAGAGTATTTCAAGGGTATCATATTTGTTTAATCC[T/C]
GTGGGAAGATTATAGTAGAGAGAACCGTACTAATAATTTATATGTTACTTGTAATAATCATAGTCTAAGTAGGGGTTAATATAATTCATAGGGTAGGATG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.10% 47.90% 0.04% 0.00% NA
All Indica  2759 81.80% 18.10% 0.07% 0.00% NA
All Japonica  1512 9.10% 90.90% 0.00% 0.00% NA
Aus  269 9.30% 90.70% 0.00% 0.00% NA
Indica I  595 84.70% 15.30% 0.00% 0.00% NA
Indica II  465 95.50% 4.30% 0.22% 0.00% NA
Indica III  913 73.70% 26.30% 0.00% 0.00% NA
Indica Intermediate  786 80.90% 19.00% 0.13% 0.00% NA
Temperate Japonica  767 0.70% 99.30% 0.00% 0.00% NA
Tropical Japonica  504 22.80% 77.20% 0.00% 0.00% NA
Japonica Intermediate  241 7.10% 92.90% 0.00% 0.00% NA
VI/Aromatic  96 8.30% 91.70% 0.00% 0.00% NA
Intermediate  90 38.90% 61.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819679743 A -> G LOC_Os08g31750.1 upstream_gene_variant ; 3115.0bp to feature; MODIFIER silent_mutation Average:40.959; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg0819679743 A -> G LOC_Os08g31760.1 upstream_gene_variant ; 3393.0bp to feature; MODIFIER silent_mutation Average:40.959; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg0819679743 A -> G LOC_Os08g31750-LOC_Os08g31760 intergenic_region ; MODIFIER silent_mutation Average:40.959; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819679743 NA 2.28E-06 mr1041_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 NA 4.14E-06 mr1147_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 NA 1.36E-06 mr1184_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 NA 2.61E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 6.20E-06 6.20E-06 mr1284_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 6.01E-06 6.01E-06 mr1286_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 NA 5.96E-07 mr1299_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 NA 2.62E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 NA 1.51E-08 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 1.51E-07 1.51E-07 mr1412_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 2.71E-06 2.71E-06 mr1417_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 NA 9.75E-06 mr1420_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 NA 3.94E-09 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 7.47E-07 2.12E-07 mr1467_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 6.96E-07 6.96E-07 mr1485_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 NA 1.46E-06 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 2.61E-06 2.61E-06 mr1488_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 4.36E-06 6.06E-07 mr1494_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 NA 8.64E-06 mr1554_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 5.31E-07 2.19E-07 mr1556_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 NA 8.71E-32 mr1571_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 NA 2.89E-08 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 4.52E-06 7.82E-07 mr1604_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 NA 5.73E-06 mr1641_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 1.12E-06 1.12E-06 mr1665_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 8.35E-06 4.53E-07 mr1683_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 1.65E-07 1.65E-07 mr1687_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 NA 2.22E-06 mr1700_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 NA 3.50E-06 mr1706_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 3.29E-06 3.29E-06 mr1727_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 8.08E-06 8.08E-06 mr1747_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 7.47E-08 7.47E-08 mr1753_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 NA 1.97E-07 mr1756_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 8.83E-07 1.32E-08 mr1759_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 3.11E-07 3.11E-07 mr1764_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 1.04E-06 2.09E-07 mr1811_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 1.78E-06 1.77E-06 mr1812_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 NA 5.97E-06 mr1814_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 1.64E-06 1.64E-06 mr1816_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 1.60E-08 1.11E-09 mr1823_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 NA 2.09E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 3.65E-07 6.18E-08 mr1824_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 NA 3.71E-11 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 NA 9.37E-08 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 2.61E-07 5.84E-08 mr1831_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 3.77E-06 3.77E-06 mr1832_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 2.55E-06 2.55E-06 mr1833_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 1.55E-07 1.07E-08 mr1838_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 2.41E-06 2.41E-06 mr1840_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 9.25E-06 9.24E-06 mr1847_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 NA 6.35E-06 mr1854_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 1.47E-06 2.71E-07 mr1856_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 NA 6.71E-06 mr1876_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 7.78E-07 1.25E-07 mr1894_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 NA 2.09E-25 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 NA 6.04E-06 mr1972_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 NA 5.96E-06 mr1976_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 6.51E-06 6.51E-06 mr1984_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819679743 8.25E-07 1.79E-07 mr1985_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251