\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819654836:

Variant ID: vg0819654836 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19654836
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.93, C: 0.08, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


GCGCGATCCCACCTCGTGTTTCCTTCTCCACATGTCTTCTTGATCCAATGCTGAAACCTTCTGCTCTGATACCACTTGTTATAAAAGTTAGTCGATATAG[C/T]
GGAAAGACGACTAACCCTCCTGATCGCTTCAGTCATTGATCACCCAAGACATGCCAGATGACGACACAGGAACATACGATATTTGTTAACGAGGTTCAGC

Reverse complement sequence

GCTGAACCTCGTTAACAAATATCGTATGTTCCTGTGTCGTCATCTGGCATGTCTTGGGTGATCAATGACTGAAGCGATCAGGAGGGTTAGTCGTCTTTCC[G/A]
CTATATCGACTAACTTTTATAACAAGTGGTATCAGAGCAGAAGGTTTCAGCATTGGATCAAGAAGACATGTGGAGAAGGAAACACGAGGTGGGATCGCGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.90% 27.00% 0.06% 0.00% NA
All Indica  2759 86.40% 13.50% 0.07% 0.00% NA
All Japonica  1512 48.10% 51.90% 0.00% 0.00% NA
Aus  269 81.80% 17.80% 0.37% 0.00% NA
Indica I  595 84.90% 15.00% 0.17% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 78.30% 21.60% 0.11% 0.00% NA
Indica Intermediate  786 90.10% 9.90% 0.00% 0.00% NA
Temperate Japonica  767 54.60% 45.40% 0.00% 0.00% NA
Tropical Japonica  504 26.40% 73.60% 0.00% 0.00% NA
Japonica Intermediate  241 72.60% 27.40% 0.00% 0.00% NA
VI/Aromatic  96 57.30% 42.70% 0.00% 0.00% NA
Intermediate  90 66.70% 33.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819654836 C -> T LOC_Os08g31720.1 upstream_gene_variant ; 519.0bp to feature; MODIFIER silent_mutation Average:39.878; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg0819654836 C -> T LOC_Os08g31700-LOC_Os08g31720 intergenic_region ; MODIFIER silent_mutation Average:39.878; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819654836 NA 6.92E-06 mr1299_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819654836 7.19E-06 7.18E-06 mr1412_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819654836 NA 6.27E-06 mr1467_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819654836 3.71E-06 2.48E-06 mr1556_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819654836 NA 3.06E-06 mr1756_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819654836 NA 2.37E-06 mr1759_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819654836 2.57E-06 2.57E-06 mr1764_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819654836 8.54E-07 1.84E-07 mr1823_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819654836 5.27E-06 2.78E-06 mr1824_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819654836 2.57E-06 1.33E-06 mr1831_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819654836 NA 8.51E-06 mr1856_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819654836 NA 4.62E-06 mr1976_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819654836 NA 8.83E-06 mr1985_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251