Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819654836:

Variant ID: vg0819654836 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 19654836
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.93, C: 0.08, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:

GCGCGATCCCACCTCGTGTTTCCTTCTCCACATGTCTTCTTGATCCAATGCTGAAACCTTCTGCTCTGATACCACTTGTTATAAAAGTTAGTCGATATAG[C/T]
GGAAAGACGACTAACCCTCCTGATCGCTTCAGTCATTGATCACCCAAGACATGCCAGATGACGACACAGGAACATACGATATTTGTTAACGAGGTTCAGC

Reverse complement sequence

GCTGAACCTCGTTAACAAATATCGTATGTTCCTGTGTCGTCATCTGGCATGTCTTGGGTGATCAATGACTGAAGCGATCAGGAGGGTTAGTCGTCTTTCC[G/A]
CTATATCGACTAACTTTTATAACAAGTGGTATCAGAGCAGAAGGTTTCAGCATTGGATCAAGAAGACATGTGGAGAAGGAAACACGAGGTGGGATCGCGC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.90%	27.00%	0.06%	0.00%	NA
All Indica	2759	86.40%	13.50%	0.07%	0.00%	NA
All Japonica	1512	48.10%	51.90%	0.00%	0.00%	NA
Aus	269	81.80%	17.80%	0.37%	0.00%	NA
Indica I	595	84.90%	15.00%	0.17%	0.00%	NA
Indica II	465	98.30%	1.70%	0.00%	0.00%	NA
Indica III	913	78.30%	21.60%	0.11%	0.00%	NA
Indica Intermediate	786	90.10%	9.90%	0.00%	0.00%	NA
Temperate Japonica	767	54.60%	45.40%	0.00%	0.00%	NA
Tropical Japonica	504	26.40%	73.60%	0.00%	0.00%	NA
Japonica Intermediate	241	72.60%	27.40%	0.00%	0.00%	NA
VI/Aromatic	96	57.30%	42.70%	0.00%	0.00%	NA
Intermediate	90	66.70%	33.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0819654836	C -> T	LOC_Os08g31720.1	upstream_gene_variant ; 519.0bp to feature; MODIFIER	silent_mutation	Average:39.878; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0819654836	C -> T	LOC_Os08g31700-LOC_Os08g31720	intergenic_region ; MODIFIER	silent_mutation	Average:39.878; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0819654836	NA	6.92E-06	mr1299_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819654836	7.19E-06	7.18E-06	mr1412_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819654836	NA	6.27E-06	mr1467_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819654836	3.71E-06	2.48E-06	mr1556_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819654836	NA	3.06E-06	mr1756_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819654836	NA	2.37E-06	mr1759_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819654836	2.57E-06	2.57E-06	mr1764_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819654836	8.54E-07	1.84E-07	mr1823_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819654836	5.27E-06	2.78E-06	mr1824_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819654836	2.57E-06	1.33E-06	mr1831_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819654836	NA	8.51E-06	mr1856_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819654836	NA	4.62E-06	mr1976_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819654836	NA	8.83E-06	mr1985_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251