\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819654266:

Variant ID: vg0819654266 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19654266
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCTGAGTCGTCGCCGCCGCCTGCATCAGACACCGAAACCGAAACTGCCACCGCTCGGATTAGAGAAACTTCTTCGCTAGAGTCCGTAGCTACTCCTCCA[C/T]
GATGGAGCCCACTGCCACCTCTCCCTGCTTAAGTTGACGTCTCCGCACCGTATCCGTCTTGGTTCTGCTCTTGGAAACCACACCTATGCATGTGTAGGTG

Reverse complement sequence

CACCTACACATGCATAGGTGTGGTTTCCAAGAGCAGAACCAAGACGGATACGGTGCGGAGACGTCAACTTAAGCAGGGAGAGGTGGCAGTGGGCTCCATC[G/A]
TGGAGGAGTAGCTACGGACTCTAGCGAAGAAGTTTCTCTAATCCGAGCGGTGGCAGTTTCGGTTTCGGTGTCTGATGCAGGCGGCGGCGACGACTCAGAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.40% 0.00% 0.76% 1.80% NA
All Indica  2759 98.80% 0.00% 1.09% 0.11% NA
All Japonica  1512 95.10% 0.00% 0.33% 4.56% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 94.00% 0.00% 5.81% 0.22% NA
Indica III  913 99.80% 0.00% 0.00% 0.22% NA
Indica Intermediate  786 99.50% 0.10% 0.38% 0.00% NA
Temperate Japonica  767 97.80% 0.00% 0.13% 2.09% NA
Tropical Japonica  504 91.10% 0.00% 0.40% 8.53% NA
Japonica Intermediate  241 95.00% 0.00% 0.83% 4.15% NA
VI/Aromatic  96 86.50% 0.00% 1.04% 12.50% NA
Intermediate  90 98.90% 0.00% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819654266 C -> T LOC_Os08g31720.1 upstream_gene_variant ; 1089.0bp to feature; MODIFIER silent_mutation Average:56.247; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0819654266 C -> T LOC_Os08g31700.1 downstream_gene_variant ; 4519.0bp to feature; MODIFIER silent_mutation Average:56.247; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0819654266 C -> T LOC_Os08g31700-LOC_Os08g31720 intergenic_region ; MODIFIER silent_mutation Average:56.247; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0819654266 C -> DEL N N silent_mutation Average:56.247; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819654266 2.46E-07 2.46E-07 mr1067_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819654266 NA 4.55E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819654266 NA 6.91E-06 mr1075_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819654266 NA 4.44E-06 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819654266 1.29E-06 8.47E-07 mr1255_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819654266 NA 1.56E-07 mr1402_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819654266 NA 7.65E-06 mr1517_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819654266 2.00E-07 2.00E-07 mr1541_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819654266 1.11E-06 1.11E-06 mr1592_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819654266 4.30E-07 6.74E-08 mr1619_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819654266 4.61E-07 1.78E-08 mr1795_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819654266 1.29E-06 NA mr1798_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819654266 NA 2.90E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819654266 NA 4.19E-06 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819654266 NA 4.72E-06 mr1962_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251