\
| Variant ID: vg0819589271 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 19589271 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTCTTTTTTTTTTCACTATGAACACACGCACGTAAACCCTACCTATGAGCATCTTCGAAAACTAGGCCGATAAATCCTGAAGAGATTGACGAAGTCACCA[T/C]
AGGCGTCTCGCTGTCGACGGGCACGTCGCCTACCACTGAAAGCACAATGCCGTTAAATCGCCTACCACTGAAAGCACAACACCGTTAAATCCTGAAAAAT
ATTTTTCAGGATTTAACGGTGTTGTGCTTTCAGTGGTAGGCGATTTAACGGCATTGTGCTTTCAGTGGTAGGCGACGTGCCCGTCGACAGCGAGACGCCT[A/G]
TGGTGACTTCGTCAATCTCTTCAGGATTTATCGGCCTAGTTTTCGAAGATGCTCATAGGTAGGGTTTACGTGCGTGTGTTCATAGTGAAAAAAAAAAGAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.10% | 34.20% | 0.13% | 0.55% | NA |
| All Indica | 2759 | 94.70% | 5.10% | 0.07% | 0.14% | NA |
| All Japonica | 1512 | 26.10% | 73.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 12.30% | 78.80% | 1.12% | 7.81% | NA |
| Indica I | 595 | 98.00% | 1.80% | 0.17% | 0.00% | NA |
| Indica II | 465 | 95.10% | 4.70% | 0.22% | 0.00% | NA |
| Indica III | 913 | 95.40% | 4.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 91.10% | 8.40% | 0.00% | 0.51% | NA |
| Temperate Japonica | 767 | 17.50% | 82.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 24.20% | 75.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 57.30% | 42.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 3.10% | 95.80% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 40.00% | 58.90% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0819589271 | T -> C | LOC_Os08g31630-LOC_Os08g31649 | intergenic_region ; MODIFIER | silent_mutation | Average:51.693; most accessible tissue: Zhenshan97 flag leaf, score: 70.007 | N | N | N | N |
| vg0819589271 | T -> DEL | N | N | silent_mutation | Average:51.693; most accessible tissue: Zhenshan97 flag leaf, score: 70.007 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0819589271 | 6.68E-07 | NA | mr1089 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819589271 | NA | 5.26E-07 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819589271 | NA | 6.79E-07 | mr1220 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819589271 | NA | 2.08E-06 | mr1240 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819589271 | NA | 1.15E-06 | mr1117_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819589271 | NA | 4.71E-06 | mr1119_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819589271 | NA | 2.40E-06 | mr1123_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819589271 | NA | 3.42E-07 | mr1240_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819589271 | NA | 2.50E-06 | mr1496_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |