\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819586766:

Variant ID: vg0819586766 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19586766
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGAGCAATGGTGCATCAGTGGTAGATCGACATGCGGTGGACAGCGGTTGAAAACCCAGACCGGCCTTGGCTAGACTGGTAATGATGGCATTCGAGCGTCA[A/C]
TCCCCTTCTGAGGGCGTTGTCGTGCTGTCTCACCCCCTCAAGTGGGGCTGCTGGGTGAAAGCCCAGTCTTGGTTCTCTTTGGGACCTTGACGGACGGCGG

Reverse complement sequence

CCGCCGTCCGTCAAGGTCCCAAAGAGAACCAAGACTGGGCTTTCACCCAGCAGCCCCACTTGAGGGGGTGAGACAGCACGACAACGCCCTCAGAAGGGGA[T/G]
TGACGCTCGAATGCCATCATTACCAGTCTAGCCAAGGCCGGTCTGGGTTTTCAACCGCTGTCCACCGCATGTCGATCTACCACTGATGCACCATTGCTCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.60% 26.40% 0.04% 0.00% NA
All Indica  2759 98.50% 1.50% 0.00% 0.00% NA
All Japonica  1512 26.70% 73.20% 0.13% 0.00% NA
Aus  269 92.60% 7.40% 0.00% 0.00% NA
Indica I  595 99.00% 1.00% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 97.30% 2.70% 0.00% 0.00% NA
Indica Intermediate  786 99.00% 1.00% 0.00% 0.00% NA
Temperate Japonica  767 17.70% 82.00% 0.26% 0.00% NA
Tropical Japonica  504 24.60% 75.40% 0.00% 0.00% NA
Japonica Intermediate  241 59.30% 40.70% 0.00% 0.00% NA
VI/Aromatic  96 57.30% 42.70% 0.00% 0.00% NA
Intermediate  90 60.00% 40.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819586766 A -> C LOC_Os08g31630.1 downstream_gene_variant ; 3394.0bp to feature; MODIFIER silent_mutation Average:74.182; most accessible tissue: Zhenshan97 flag leaf, score: 92.52 N N N N
vg0819586766 A -> C LOC_Os08g31630.2 downstream_gene_variant ; 3394.0bp to feature; MODIFIER silent_mutation Average:74.182; most accessible tissue: Zhenshan97 flag leaf, score: 92.52 N N N N
vg0819586766 A -> C LOC_Os08g31630-LOC_Os08g31649 intergenic_region ; MODIFIER silent_mutation Average:74.182; most accessible tissue: Zhenshan97 flag leaf, score: 92.52 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0819586766 A C 0.01 0.01 0.02 0.01 0.01 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819586766 NA 5.96E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819586766 NA 3.38E-15 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819586766 NA 3.15E-06 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819586766 1.51E-07 NA mr1123 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819586766 NA 1.94E-07 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819586766 NA 3.73E-06 mr1240 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819586766 NA 8.19E-10 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819586766 7.12E-06 NA mr1858 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819586766 6.96E-06 NA mr1859 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819586766 NA 3.77E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819586766 5.76E-08 NA mr1936 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819586766 NA 8.57E-17 mr1114_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819586766 1.94E-06 NA mr1117_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819586766 NA 2.12E-06 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819586766 NA 4.57E-06 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819586766 2.46E-06 NA mr1119_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819586766 NA 5.19E-06 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819586766 4.85E-06 NA mr1120_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819586766 5.67E-07 NA mr1123_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819586766 NA 1.73E-06 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819586766 NA 4.37E-07 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819586766 9.44E-06 NA mr1247_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819586766 NA 5.11E-15 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819586766 NA 2.10E-06 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819586766 8.59E-06 NA mr1936_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251