\
| Variant ID: vg0819561125 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 19561125 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AATATGTTGCTGGTTGCTGCACGCGAGATACGAACCACTTCCCGTGTAACCAACTAAACACGTCCTAAGCCCATCCGATCTCTAAAAAGATACTCCCTCC[A/G]
TTTCAAAATGTTTGACACCGTTGACTTTTTAGTACGTGTTTGACCATTCGTCTTATTCAAAAAATTTAAGTAATTATTTATTCTTTTCATGTCATTTGAT
ATCAAATGACATGAAAAGAATAAATAATTACTTAAATTTTTTGAATAAGACGAATGGTCAAACACGTACTAAAAAGTCAACGGTGTCAAACATTTTGAAA[T/C]
GGAGGGAGTATCTTTTTAGAGATCGGATGGGCTTAGGACGTGTTTAGTTGGTTACACGGGAAGTGGTTCGTATCTCGCGTGCAGCAACCAGCAACATATT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.10% | 35.80% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 92.10% | 7.90% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 11.70% | 88.20% | 0.07% | 0.00% | NA |
| Aus | 269 | 77.30% | 22.30% | 0.37% | 0.00% | NA |
| Indica I | 595 | 98.30% | 1.50% | 0.17% | 0.00% | NA |
| Indica II | 465 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 82.70% | 17.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.50% | 5.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 0.70% | 99.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 28.40% | 71.40% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 12.00% | 88.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 58.30% | 41.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 54.40% | 43.30% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0819561125 | A -> G | LOC_Os08g31600.1 | downstream_gene_variant ; 4105.0bp to feature; MODIFIER | silent_mutation | Average:51.976; most accessible tissue: Zhenshan97 flower, score: 85.807 | N | N | N | N |
| vg0819561125 | A -> G | LOC_Os08g31610.1 | downstream_gene_variant ; 651.0bp to feature; MODIFIER | silent_mutation | Average:51.976; most accessible tissue: Zhenshan97 flower, score: 85.807 | N | N | N | N |
| vg0819561125 | A -> G | LOC_Os08g31610-LOC_Os08g31620 | intergenic_region ; MODIFIER | silent_mutation | Average:51.976; most accessible tissue: Zhenshan97 flower, score: 85.807 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0819561125 | NA | 2.68E-06 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819561125 | 1.38E-06 | 9.52E-07 | mr1283_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819561125 | 3.42E-06 | 3.42E-06 | mr1418_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819561125 | 7.01E-06 | 5.47E-06 | mr1467_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819561125 | 2.30E-06 | 2.71E-06 | mr1838_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |