\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819540823:

Variant ID: vg0819540823 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19540823
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


GCCTGTCAGAGGCATGTCAGGGGGCCGAGGATCTCTAAAGATTACCACTTTAGTCCCGGTTGGTAACACCAACCGGGAGTAAAGATCTATCTTTAGTTTC[G/A]
GTTAAAAATCCAACCGGGAGTAAATATTTCTCTCCCATATCTAATGGTTAAGTCCCAGACCAACTTCCTCCTCATCATATATTCTCCTCCTATCTCTCAG

Reverse complement sequence

CTGAGAGATAGGAGGAGAATATATGATGAGGAGGAAGTTGGTCTGGGACTTAACCATTAGATATGGGAGAGAAATATTTACTCCCGGTTGGATTTTTAAC[C/T]
GAAACTAAAGATAGATCTTTACTCCCGGTTGGTGTTACCAACCGGGACTAAAGTGGTAATCTTTAGAGATCCTCGGCCCCCTGACATGCCTCTGACAGGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.90% 39.90% 0.28% 0.00% NA
All Indica  2759 49.60% 50.10% 0.29% 0.00% NA
All Japonica  1512 84.90% 15.10% 0.00% 0.00% NA
Aus  269 25.30% 73.60% 1.12% 0.00% NA
Indica I  595 52.10% 47.60% 0.34% 0.00% NA
Indica II  465 81.30% 18.70% 0.00% 0.00% NA
Indica III  913 36.50% 63.40% 0.11% 0.00% NA
Indica Intermediate  786 44.30% 55.10% 0.64% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 60.90% 39.10% 0.00% 0.00% NA
Japonica Intermediate  241 88.00% 12.00% 0.00% 0.00% NA
VI/Aromatic  96 51.00% 46.90% 2.08% 0.00% NA
Intermediate  90 65.60% 34.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819540823 G -> A LOC_Os08g31569-LOC_Os08g31580 intergenic_region ; MODIFIER silent_mutation Average:63.467; most accessible tissue: Callus, score: 86.13 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819540823 NA 7.61E-07 mr1073 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819540823 NA 3.88E-06 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819540823 NA 1.84E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819540823 NA 1.05E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819540823 NA 5.82E-07 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819540823 NA 9.71E-07 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819540823 1.85E-07 1.85E-07 mr1366_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819540823 NA 9.29E-06 mr1391_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819540823 NA 1.87E-06 mr1421_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819540823 NA 9.41E-06 mr1469_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819540823 NA 9.61E-08 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819540823 NA 1.25E-06 mr1511_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819540823 NA 3.75E-06 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819540823 NA 1.90E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819540823 NA 1.66E-06 mr1562_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819540823 3.74E-06 3.73E-06 mr1615_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819540823 NA 7.73E-06 mr1729_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819540823 NA 9.35E-06 mr1743_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819540823 NA 9.45E-08 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819540823 NA 1.08E-06 mr1759_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819540823 NA 3.83E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819540823 NA 7.95E-06 mr1814_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819540823 NA 1.59E-08 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819540823 NA 3.69E-06 mr1876_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819540823 3.26E-06 3.27E-06 mr1985_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251