\
| Variant ID: vg0819538105 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr08 | Position: 19538105 |
| Reference Allele: C | Alternative Allele: T,CA |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.04, others allele: 0.00, population size: 117. )
CGGCGGCTGGATTAGGCTTCCAGGGCGGCTTTTCATTTTTTATTTTTCCGTGCAAGTGGCTTAAGCGCCTACAGATTTTCACGTGTGGGCGCATCACCCG[C/T,CA]
ACAAAAAAAAGTTAGATTTTCGTAGACACCTCGTTCCAGACGGGTAGAAGATCCACACGCGATAACTGATTCTGATCACACGAAAAAATAGTTATCGTAG
CTACGATAACTATTTTTTCGTGTGATCAGAATCAGTTATCGCGTGTGGATCTTCTACCCGTCTGGAACGAGGTGTCTACGAAAATCTAACTTTTTTTTGT[G/A,TG]
CGGGTGATGCGCCCACACGTGAAAATCTGTAGGCGCTTAAGCCACTTGCACGGAAAAATAAAAAATGAAAAGCCGCCCTGGAAGCCTAATCCAGCCGCCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.70% | 32.10% | 0.95% | 0.28% | CA: 0.04% |
| All Indica | 2759 | 60.50% | 38.60% | 0.83% | 0.04% | NA |
| All Japonica | 1512 | 84.90% | 14.90% | 0.20% | 0.00% | NA |
| Aus | 269 | 33.50% | 55.80% | 6.32% | 4.46% | NA |
| Indica I | 595 | 65.90% | 33.40% | 0.67% | 0.00% | NA |
| Indica II | 465 | 82.20% | 15.90% | 1.94% | 0.00% | NA |
| Indica III | 913 | 52.60% | 47.30% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 52.80% | 45.90% | 1.15% | 0.13% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 60.50% | 39.10% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 88.00% | 11.60% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 53.10% | 46.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 64.40% | 31.10% | 2.22% | 0.00% | CA: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0819538105 | C -> T | LOC_Os08g31569.1 | upstream_gene_variant ; 4956.0bp to feature; MODIFIER | silent_mutation | Average:71.583; most accessible tissue: Callus, score: 92.42 | N | N | N | N |
| vg0819538105 | C -> T | LOC_Os08g31569-LOC_Os08g31580 | intergenic_region ; MODIFIER | silent_mutation | Average:71.583; most accessible tissue: Callus, score: 92.42 | N | N | N | N |
| vg0819538105 | C -> DEL | N | N | silent_mutation | Average:71.583; most accessible tissue: Callus, score: 92.42 | N | N | N | N |
| vg0819538105 | C -> CA | LOC_Os08g31569.1 | upstream_gene_variant ; 4957.0bp to feature; MODIFIER | silent_mutation | Average:71.583; most accessible tissue: Callus, score: 92.42 | N | N | N | N |
| vg0819538105 | C -> CA | LOC_Os08g31569-LOC_Os08g31580 | intergenic_region ; MODIFIER | silent_mutation | Average:71.583; most accessible tissue: Callus, score: 92.42 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0819538105 | NA | 1.59E-06 | mr1073 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819538105 | NA | 1.66E-06 | mr1851 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819538105 | NA | 2.26E-07 | mr1063_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819538105 | NA | 7.38E-06 | mr1260_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819538105 | 1.46E-06 | 1.46E-06 | mr1366_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819538105 | NA | 1.17E-06 | mr1421_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819538105 | NA | 3.74E-06 | mr1421_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819538105 | NA | 7.64E-07 | mr1510_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819538105 | NA | 1.07E-07 | mr1555_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819538105 | 1.15E-06 | 1.14E-06 | mr1615_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819538105 | 9.14E-06 | 9.12E-06 | mr1752_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819538105 | NA | 2.87E-06 | mr1763_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819538105 | NA | 3.32E-08 | mr1837_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |