\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819538105:

Variant ID: vg0819538105 (JBrowse)Variation Type: INDEL
Chromosome: chr08Position: 19538105
Reference Allele: CAlternative Allele: T,CA
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.04, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


CGGCGGCTGGATTAGGCTTCCAGGGCGGCTTTTCATTTTTTATTTTTCCGTGCAAGTGGCTTAAGCGCCTACAGATTTTCACGTGTGGGCGCATCACCCG[C/T,CA]
ACAAAAAAAAGTTAGATTTTCGTAGACACCTCGTTCCAGACGGGTAGAAGATCCACACGCGATAACTGATTCTGATCACACGAAAAAATAGTTATCGTAG

Reverse complement sequence

CTACGATAACTATTTTTTCGTGTGATCAGAATCAGTTATCGCGTGTGGATCTTCTACCCGTCTGGAACGAGGTGTCTACGAAAATCTAACTTTTTTTTGT[G/A,TG]
CGGGTGATGCGCCCACACGTGAAAATCTGTAGGCGCTTAAGCCACTTGCACGGAAAAATAAAAAATGAAAAGCCGCCCTGGAAGCCTAATCCAGCCGCCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.70% 32.10% 0.95% 0.28% CA: 0.04%
All Indica  2759 60.50% 38.60% 0.83% 0.04% NA
All Japonica  1512 84.90% 14.90% 0.20% 0.00% NA
Aus  269 33.50% 55.80% 6.32% 4.46% NA
Indica I  595 65.90% 33.40% 0.67% 0.00% NA
Indica II  465 82.20% 15.90% 1.94% 0.00% NA
Indica III  913 52.60% 47.30% 0.11% 0.00% NA
Indica Intermediate  786 52.80% 45.90% 1.15% 0.13% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 60.50% 39.10% 0.40% 0.00% NA
Japonica Intermediate  241 88.00% 11.60% 0.41% 0.00% NA
VI/Aromatic  96 53.10% 46.90% 0.00% 0.00% NA
Intermediate  90 64.40% 31.10% 2.22% 0.00% CA: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819538105 C -> T LOC_Os08g31569.1 upstream_gene_variant ; 4956.0bp to feature; MODIFIER silent_mutation Average:71.583; most accessible tissue: Callus, score: 92.42 N N N N
vg0819538105 C -> T LOC_Os08g31569-LOC_Os08g31580 intergenic_region ; MODIFIER silent_mutation Average:71.583; most accessible tissue: Callus, score: 92.42 N N N N
vg0819538105 C -> DEL N N silent_mutation Average:71.583; most accessible tissue: Callus, score: 92.42 N N N N
vg0819538105 C -> CA LOC_Os08g31569.1 upstream_gene_variant ; 4957.0bp to feature; MODIFIER silent_mutation Average:71.583; most accessible tissue: Callus, score: 92.42 N N N N
vg0819538105 C -> CA LOC_Os08g31569-LOC_Os08g31580 intergenic_region ; MODIFIER silent_mutation Average:71.583; most accessible tissue: Callus, score: 92.42 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819538105 NA 1.59E-06 mr1073 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819538105 NA 1.66E-06 mr1851 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819538105 NA 2.26E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819538105 NA 7.38E-06 mr1260_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819538105 1.46E-06 1.46E-06 mr1366_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819538105 NA 1.17E-06 mr1421_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819538105 NA 3.74E-06 mr1421_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819538105 NA 7.64E-07 mr1510_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819538105 NA 1.07E-07 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819538105 1.15E-06 1.14E-06 mr1615_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819538105 9.14E-06 9.12E-06 mr1752_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819538105 NA 2.87E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819538105 NA 3.32E-08 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251