\
| Variant ID: vg0819535046 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 19535046 |
| Reference Allele: G | Alternative Allele: A,C |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 115. )
TAAAATCTAGCATTGACTACATTGTTCGTACCCATATGGTTGAGCTATGGAGGAGAACGTGCGTCTACAGTAACATCCCTGATTATAGAGGTGGTGTTTG[G/A,C]
ATCCAGGGACTTAACTTTAGTCCCTATATTTAGACACTAATTTAGAGTATTAAATATAGACTACTTACAAAACTAATTATATAAATGAAAGCTAATTCGC
GCGAATTAGCTTTCATTTATATAATTAGTTTTGTAAGTAGTCTATATTTAATACTCTAAATTAGTGTCTAAATATAGGGACTAAAGTTAAGTCCCTGGAT[C/T,G]
CAAACACCACCTCTATAATCAGGGATGTTACTGTAGACGCACGTTCTCCTCCATAGCTCAACCATATGGGTACGAACAATGTAGTCAATGCTAGATTTTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.20% | 32.10% | 0.34% | 0.21% | C: 0.15% |
| All Indica | 2759 | 61.20% | 38.50% | 0.22% | 0.00% | C: 0.07% |
| All Japonica | 1512 | 84.70% | 15.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 39.80% | 55.80% | 0.74% | 3.72% | NA |
| Indica I | 595 | 66.60% | 33.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 84.30% | 15.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 52.60% | 47.10% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 53.40% | 45.90% | 0.38% | 0.00% | C: 0.25% |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 60.30% | 39.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 87.10% | 12.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 44.80% | 46.90% | 3.12% | 0.00% | C: 5.21% |
| Intermediate | 90 | 65.60% | 30.00% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0819535046 | G -> C | LOC_Os08g31569.1 | upstream_gene_variant ; 1897.0bp to feature; MODIFIER | silent_mutation | Average:44.734; most accessible tissue: Callus, score: 80.829 | N | N | N | N |
| vg0819535046 | G -> C | LOC_Os08g31569-LOC_Os08g31580 | intergenic_region ; MODIFIER | silent_mutation | Average:44.734; most accessible tissue: Callus, score: 80.829 | N | N | N | N |
| vg0819535046 | G -> A | LOC_Os08g31569.1 | upstream_gene_variant ; 1897.0bp to feature; MODIFIER | silent_mutation | Average:44.734; most accessible tissue: Callus, score: 80.829 | N | N | N | N |
| vg0819535046 | G -> A | LOC_Os08g31569-LOC_Os08g31580 | intergenic_region ; MODIFIER | silent_mutation | Average:44.734; most accessible tissue: Callus, score: 80.829 | N | N | N | N |
| vg0819535046 | G -> DEL | N | N | silent_mutation | Average:44.734; most accessible tissue: Callus, score: 80.829 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0819535046 | NA | 6.56E-06 | mr1042 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819535046 | NA | 5.42E-06 | mr1043 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819535046 | NA | 7.61E-07 | mr1073 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819535046 | NA | 3.88E-06 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819535046 | NA | 3.21E-06 | mr1851 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819535046 | NA | 8.23E-07 | mr1063_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819535046 | 3.02E-06 | 3.01E-06 | mr1366_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819535046 | NA | 8.22E-07 | mr1421_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819535046 | NA | 1.92E-06 | mr1421_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819535046 | NA | 5.43E-07 | mr1510_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819535046 | NA | 2.47E-07 | mr1555_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819535046 | 3.12E-06 | 3.11E-06 | mr1615_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819535046 | 4.52E-06 | 4.51E-06 | mr1752_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819535046 | NA | 1.50E-06 | mr1763_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819535046 | NA | 5.42E-08 | mr1837_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819535046 | 9.56E-06 | 9.58E-06 | mr1985_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |