Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819535046:

Variant ID: vg0819535046 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 19535046
Reference Allele: G	Alternative Allele: A,C
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:

TAAAATCTAGCATTGACTACATTGTTCGTACCCATATGGTTGAGCTATGGAGGAGAACGTGCGTCTACAGTAACATCCCTGATTATAGAGGTGGTGTTTG[G/A,C]
ATCCAGGGACTTAACTTTAGTCCCTATATTTAGACACTAATTTAGAGTATTAAATATAGACTACTTACAAAACTAATTATATAAATGAAAGCTAATTCGC

Reverse complement sequence

GCGAATTAGCTTTCATTTATATAATTAGTTTTGTAAGTAGTCTATATTTAATACTCTAAATTAGTGTCTAAATATAGGGACTAAAGTTAAGTCCCTGGAT[C/T,G]
CAAACACCACCTCTATAATCAGGGATGTTACTGTAGACGCACGTTCTCCTCCATAGCTCAACCATATGGGTACGAACAATGTAGTCAATGCTAGATTTTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.20%	32.10%	0.34%	0.21%	C: 0.15%
All Indica	2759	61.20%	38.50%	0.22%	0.00%	C: 0.07%
All Japonica	1512	84.70%	15.30%	0.07%	0.00%	NA
Aus	269	39.80%	55.80%	0.74%	3.72%	NA
Indica I	595	66.60%	33.40%	0.00%	0.00%	NA
Indica II	465	84.30%	15.70%	0.00%	0.00%	NA
Indica III	913	52.60%	47.10%	0.33%	0.00%	NA
Indica Intermediate	786	53.40%	45.90%	0.38%	0.00%	C: 0.25%
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	60.30%	39.70%	0.00%	0.00%	NA
Japonica Intermediate	241	87.10%	12.40%	0.41%	0.00%	NA
VI/Aromatic	96	44.80%	46.90%	3.12%	0.00%	C: 5.21%
Intermediate	90	65.60%	30.00%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0819535046	G -> C	LOC_Os08g31569.1	upstream_gene_variant ; 1897.0bp to feature; MODIFIER	silent_mutation	Average:44.734; most accessible tissue: Callus, score: 80.829	N	N	N	N
vg0819535046	G -> C	LOC_Os08g31569-LOC_Os08g31580	intergenic_region ; MODIFIER	silent_mutation	Average:44.734; most accessible tissue: Callus, score: 80.829	N	N	N	N
vg0819535046	G -> A	LOC_Os08g31569.1	upstream_gene_variant ; 1897.0bp to feature; MODIFIER	silent_mutation	Average:44.734; most accessible tissue: Callus, score: 80.829	N	N	N	N
vg0819535046	G -> A	LOC_Os08g31569-LOC_Os08g31580	intergenic_region ; MODIFIER	silent_mutation	Average:44.734; most accessible tissue: Callus, score: 80.829	N	N	N	N
vg0819535046	G -> DEL	N	N	silent_mutation	Average:44.734; most accessible tissue: Callus, score: 80.829	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0819535046	NA	6.56E-06	mr1042	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819535046	NA	5.42E-06	mr1043	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819535046	NA	7.61E-07	mr1073	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819535046	NA	3.88E-06	mr1830	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819535046	NA	3.21E-06	mr1851	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819535046	NA	8.23E-07	mr1063_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819535046	3.02E-06	3.01E-06	mr1366_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819535046	NA	8.22E-07	mr1421_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819535046	NA	1.92E-06	mr1421_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819535046	NA	5.43E-07	mr1510_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819535046	NA	2.47E-07	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819535046	3.12E-06	3.11E-06	mr1615_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819535046	4.52E-06	4.51E-06	mr1752_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819535046	NA	1.50E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819535046	NA	5.42E-08	mr1837_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819535046	9.56E-06	9.58E-06	mr1985_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251