\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819535046:

Variant ID: vg0819535046 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19535046
Reference Allele: GAlternative Allele: A,C
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


TAAAATCTAGCATTGACTACATTGTTCGTACCCATATGGTTGAGCTATGGAGGAGAACGTGCGTCTACAGTAACATCCCTGATTATAGAGGTGGTGTTTG[G/A,C]
ATCCAGGGACTTAACTTTAGTCCCTATATTTAGACACTAATTTAGAGTATTAAATATAGACTACTTACAAAACTAATTATATAAATGAAAGCTAATTCGC

Reverse complement sequence

GCGAATTAGCTTTCATTTATATAATTAGTTTTGTAAGTAGTCTATATTTAATACTCTAAATTAGTGTCTAAATATAGGGACTAAAGTTAAGTCCCTGGAT[C/T,G]
CAAACACCACCTCTATAATCAGGGATGTTACTGTAGACGCACGTTCTCCTCCATAGCTCAACCATATGGGTACGAACAATGTAGTCAATGCTAGATTTTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.20% 32.10% 0.34% 0.21% C: 0.15%
All Indica  2759 61.20% 38.50% 0.22% 0.00% C: 0.07%
All Japonica  1512 84.70% 15.30% 0.07% 0.00% NA
Aus  269 39.80% 55.80% 0.74% 3.72% NA
Indica I  595 66.60% 33.40% 0.00% 0.00% NA
Indica II  465 84.30% 15.70% 0.00% 0.00% NA
Indica III  913 52.60% 47.10% 0.33% 0.00% NA
Indica Intermediate  786 53.40% 45.90% 0.38% 0.00% C: 0.25%
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 60.30% 39.70% 0.00% 0.00% NA
Japonica Intermediate  241 87.10% 12.40% 0.41% 0.00% NA
VI/Aromatic  96 44.80% 46.90% 3.12% 0.00% C: 5.21%
Intermediate  90 65.60% 30.00% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819535046 G -> C LOC_Os08g31569.1 upstream_gene_variant ; 1897.0bp to feature; MODIFIER silent_mutation Average:44.734; most accessible tissue: Callus, score: 80.829 N N N N
vg0819535046 G -> C LOC_Os08g31569-LOC_Os08g31580 intergenic_region ; MODIFIER silent_mutation Average:44.734; most accessible tissue: Callus, score: 80.829 N N N N
vg0819535046 G -> A LOC_Os08g31569.1 upstream_gene_variant ; 1897.0bp to feature; MODIFIER silent_mutation Average:44.734; most accessible tissue: Callus, score: 80.829 N N N N
vg0819535046 G -> A LOC_Os08g31569-LOC_Os08g31580 intergenic_region ; MODIFIER silent_mutation Average:44.734; most accessible tissue: Callus, score: 80.829 N N N N
vg0819535046 G -> DEL N N silent_mutation Average:44.734; most accessible tissue: Callus, score: 80.829 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819535046 NA 6.56E-06 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819535046 NA 5.42E-06 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819535046 NA 7.61E-07 mr1073 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819535046 NA 3.88E-06 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819535046 NA 3.21E-06 mr1851 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819535046 NA 8.23E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819535046 3.02E-06 3.01E-06 mr1366_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819535046 NA 8.22E-07 mr1421_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819535046 NA 1.92E-06 mr1421_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819535046 NA 5.43E-07 mr1510_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819535046 NA 2.47E-07 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819535046 3.12E-06 3.11E-06 mr1615_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819535046 4.52E-06 4.51E-06 mr1752_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819535046 NA 1.50E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819535046 NA 5.42E-08 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819535046 9.56E-06 9.58E-06 mr1985_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251