\
| Variant ID: vg0819479739 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 19479739 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATTTCTCTCGGTTCATTTGTGATGCTAACTGATACTAAGTTGTGATGTAATTCAAATTATTGTTGATAACCGATAATTTGGTAAATTATTGATTTTATTT[C/T]
TCTTTATTAAATTACATATCTTTCAAGTTATTATTCAAGTGAGATCCATTGGGTACCCGCCGGATATACCCGCGCCCGCTGGGCATGGGCACGGGCACGG
CCGTGCCCGTGCCCATGCCCAGCGGGCGCGGGTATATCCGGCGGGTACCCAATGGATCTCACTTGAATAATAACTTGAAAGATATGTAATTTAATAAAGA[G/A]
AAATAAAATCAATAATTTACCAAATTATCGGTTATCAACAATAATTTGAATTACATCACAACTTAGTATCAGTTAGCATCACAAATGAACCGAGAGAAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.70% | 4.80% | 1.46% | 0.00% | NA |
| All Indica | 2759 | 98.30% | 0.30% | 1.49% | 0.00% | NA |
| All Japonica | 1512 | 84.10% | 14.40% | 1.52% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.20% | 0.30% | 1.51% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.00% | 0.86% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.10% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 96.20% | 0.50% | 3.31% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 57.10% | 38.50% | 4.37% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.00% | 9.50% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 5.60% | 5.56% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0819479739 | C -> T | LOC_Os08g31480-LOC_Os08g31510 | intergenic_region ; MODIFIER | silent_mutation | Average:62.14; most accessible tissue: Minghui63 panicle, score: 82.128 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0819479739 | 2.41E-07 | 5.18E-10 | mr1073 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819479739 | 7.01E-06 | 7.01E-06 | mr1153 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819479739 | NA | 5.69E-06 | mr1262 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819479739 | 8.82E-06 | 8.82E-06 | mr1266 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819479739 | NA | 2.01E-06 | mr1345 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819479739 | NA | 5.44E-06 | mr1388 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819479739 | 2.34E-06 | 2.34E-06 | mr1601 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819479739 | NA | 1.71E-07 | mr1606 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819479739 | 3.69E-06 | 8.46E-07 | mr1819 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819479739 | NA | 2.18E-08 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819479739 | 5.26E-06 | 1.69E-10 | mr1852 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819479739 | NA | 3.81E-07 | mr1866 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |