\
| Variant ID: vg0819478073 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 19478073 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTCATATTTAAGTTTTTTCAAATAAGTTGTTCCTGTGCATGTACTCTCCGTCCTCTAATATAAGGGATTTTGATATTTTTCTTGTACTGTTTTACCATTC[A/G]
TCTTATTAAAAAAATTTGAAATTATTATTTATTTTATTTGTGACCTACTTTATTATCCAAAGTACTTTAAGCACAACTTTTCGGTTTAATATTTGCACAA
TTGTGCAAATATTAAACCGAAAAGTTGTGCTTAAAGTACTTTGGATAATAAAGTAGGTCACAAATAAAATAAATAATAATTTCAAATTTTTTTAATAAGA[T/C]
GAATGGTAAAACAGTACAAGAAAAATATCAAAATCCCTTATATTAGAGGACGGAGAGTACATGCACAGGAACAACTTATTTGAAAAAACTTAAATATGAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.90% | 36.10% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 94.60% | 5.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 18.10% | 81.80% | 0.13% | 0.00% | NA |
| Aus | 269 | 27.90% | 72.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 94.00% | 6.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 0.70% | 99.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 46.80% | 52.80% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 13.30% | 86.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 10.40% | 89.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 56.70% | 43.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0819478073 | A -> G | LOC_Os08g31480.1 | upstream_gene_variant ; 4011.0bp to feature; MODIFIER | silent_mutation | Average:51.012; most accessible tissue: Minghui63 flag leaf, score: 79.085 | N | N | N | N |
| vg0819478073 | A -> G | LOC_Os08g31480-LOC_Os08g31510 | intergenic_region ; MODIFIER | silent_mutation | Average:51.012; most accessible tissue: Minghui63 flag leaf, score: 79.085 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0819478073 | 7.97E-06 | 3.92E-08 | mr1073 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819478073 | NA | 7.97E-14 | mr1218 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819478073 | NA | 1.68E-06 | mr1350 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819478073 | NA | 6.04E-19 | mr1422 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819478073 | NA | 8.89E-06 | mr1450 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819478073 | NA | 7.56E-24 | mr1571 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819478073 | NA | 9.83E-16 | mr1583 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819478073 | NA | 1.00E-06 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819478073 | NA | 3.47E-07 | mr1850 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819478073 | 6.76E-08 | NA | mr1852 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819478073 | 4.95E-06 | 3.00E-10 | mr1852 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819478073 | NA | 4.82E-06 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |