\
| Variant ID: vg0819478065 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 19478065 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGAGATATTTCATATTTAAGTTTTTTCAAATAAGTTGTTCCTGTGCATGTACTCTCCGTCCTCTAATATAAGGGATTTTGATATTTTTCTTGTACTGTTT[T/C]
ACCATTCATCTTATTAAAAAAATTTGAAATTATTATTTATTTTATTTGTGACCTACTTTATTATCCAAAGTACTTTAAGCACAACTTTTCGGTTTAATAT
ATATTAAACCGAAAAGTTGTGCTTAAAGTACTTTGGATAATAAAGTAGGTCACAAATAAAATAAATAATAATTTCAAATTTTTTTAATAAGATGAATGGT[A/G]
AAACAGTACAAGAAAAATATCAAAATCCCTTATATTAGAGGACGGAGAGTACATGCACAGGAACAACTTATTTGAAAAAACTTAAATATGAAATATCTCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.50% | 29.50% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 18.50% | 81.50% | 0.07% | 0.00% | NA |
| Aus | 269 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.30% | 2.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 47.20% | 52.60% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 14.50% | 85.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 55.20% | 44.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 67.80% | 32.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0819478065 | T -> C | LOC_Os08g31480.1 | upstream_gene_variant ; 4003.0bp to feature; MODIFIER | silent_mutation | Average:53.365; most accessible tissue: Minghui63 flag leaf, score: 82.521 | N | N | N | N |
| vg0819478065 | T -> C | LOC_Os08g31480-LOC_Os08g31510 | intergenic_region ; MODIFIER | silent_mutation | Average:53.365; most accessible tissue: Minghui63 flag leaf, score: 82.521 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0819478065 | 1.57E-06 | 2.70E-06 | mr1073 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819478065 | 7.97E-06 | 3.92E-08 | mr1073 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819478065 | NA | 1.68E-06 | mr1350 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819478065 | NA | 7.45E-28 | mr1638 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819478065 | NA | 1.57E-06 | mr1646 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819478065 | NA | 6.32E-11 | mr1714 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819478065 | NA | 6.40E-16 | mr1830 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819478065 | NA | 1.00E-06 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819478065 | 4.95E-06 | 3.00E-10 | mr1852 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819478065 | NA | 3.33E-06 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |