\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819463121:

Variant ID: vg0819463121 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19463121
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


CATAACCCGTATTGTCTTTTAAATTCGGAGCCGGGTACGGTTAGTACCGAATAACATATCACTCATCCTCTAATCCTATCCCATATTATTTCCTTCGCAT[C/T]
GGATTCGGGAACGGATATTAATTTGTATCTCTAATTCATATATTAAATATAATAAGGTAATTAAAGCACTAAAGAGATACATCAAGAAAAAATATAAAAT

Reverse complement sequence

ATTTTATATTTTTTCTTGATGTATCTCTTTAGTGCTTTAATTACCTTATTATATTTAATATATGAATTAGAGATACAAATTAATATCCGTTCCCGAATCC[G/A]
ATGCGAAGGAAATAATATGGGATAGGATTAGAGGATGAGTGATATGTTATTCGGTACTAACCGTACCCGGCTCCGAATTTAAAAGACAATACGGGTTATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.80% 24.00% 0.19% 0.00% NA
All Indica  2759 68.50% 31.30% 0.22% 0.00% NA
All Japonica  1512 83.30% 16.60% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 91.10% 8.90% 0.00% 0.00% NA
Indica II  465 90.10% 9.90% 0.00% 0.00% NA
Indica III  913 48.70% 51.00% 0.22% 0.00% NA
Indica Intermediate  786 61.60% 37.90% 0.51% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 55.20% 44.60% 0.20% 0.00% NA
Japonica Intermediate  241 88.80% 10.80% 0.41% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 80.00% 18.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819463121 C -> T LOC_Os08g31470.1 upstream_gene_variant ; 805.0bp to feature; MODIFIER silent_mutation Average:64.959; most accessible tissue: Zhenshan97 flower, score: 84.874 N N N N
vg0819463121 C -> T LOC_Os08g31470.4 upstream_gene_variant ; 805.0bp to feature; MODIFIER silent_mutation Average:64.959; most accessible tissue: Zhenshan97 flower, score: 84.874 N N N N
vg0819463121 C -> T LOC_Os08g31470.2 upstream_gene_variant ; 1457.0bp to feature; MODIFIER silent_mutation Average:64.959; most accessible tissue: Zhenshan97 flower, score: 84.874 N N N N
vg0819463121 C -> T LOC_Os08g31470.3 upstream_gene_variant ; 2203.0bp to feature; MODIFIER silent_mutation Average:64.959; most accessible tissue: Zhenshan97 flower, score: 84.874 N N N N
vg0819463121 C -> T LOC_Os08g31460.1 downstream_gene_variant ; 2679.0bp to feature; MODIFIER silent_mutation Average:64.959; most accessible tissue: Zhenshan97 flower, score: 84.874 N N N N
vg0819463121 C -> T LOC_Os08g31460-LOC_Os08g31470 intergenic_region ; MODIFIER silent_mutation Average:64.959; most accessible tissue: Zhenshan97 flower, score: 84.874 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819463121 NA 6.06E-07 mr1073 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819463121 NA 1.54E-07 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819463121 6.70E-07 6.70E-07 mr1413 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819463121 4.06E-06 NA mr1552 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819463121 NA 1.01E-08 mr1552 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819463121 NA 5.72E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819463121 NA 5.24E-06 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819463121 NA 5.55E-07 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819463121 NA 1.43E-08 mr1852 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819463121 NA 3.63E-07 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819463121 NA 3.63E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819463121 NA 2.67E-07 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251