\
| Variant ID: vg0819463121 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 19463121 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 222. )
CATAACCCGTATTGTCTTTTAAATTCGGAGCCGGGTACGGTTAGTACCGAATAACATATCACTCATCCTCTAATCCTATCCCATATTATTTCCTTCGCAT[C/T]
GGATTCGGGAACGGATATTAATTTGTATCTCTAATTCATATATTAAATATAATAAGGTAATTAAAGCACTAAAGAGATACATCAAGAAAAAATATAAAAT
ATTTTATATTTTTTCTTGATGTATCTCTTTAGTGCTTTAATTACCTTATTATATTTAATATATGAATTAGAGATACAAATTAATATCCGTTCCCGAATCC[G/A]
ATGCGAAGGAAATAATATGGGATAGGATTAGAGGATGAGTGATATGTTATTCGGTACTAACCGTACCCGGCTCCGAATTTAAAAGACAATACGGGTTATG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.80% | 24.00% | 0.19% | 0.00% | NA |
| All Indica | 2759 | 68.50% | 31.30% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 83.30% | 16.60% | 0.13% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 90.10% | 9.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 48.70% | 51.00% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 61.60% | 37.90% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 55.20% | 44.60% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 88.80% | 10.80% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 18.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0819463121 | C -> T | LOC_Os08g31470.1 | upstream_gene_variant ; 805.0bp to feature; MODIFIER | silent_mutation | Average:64.959; most accessible tissue: Zhenshan97 flower, score: 84.874 | N | N | N | N |
| vg0819463121 | C -> T | LOC_Os08g31470.4 | upstream_gene_variant ; 805.0bp to feature; MODIFIER | silent_mutation | Average:64.959; most accessible tissue: Zhenshan97 flower, score: 84.874 | N | N | N | N |
| vg0819463121 | C -> T | LOC_Os08g31470.2 | upstream_gene_variant ; 1457.0bp to feature; MODIFIER | silent_mutation | Average:64.959; most accessible tissue: Zhenshan97 flower, score: 84.874 | N | N | N | N |
| vg0819463121 | C -> T | LOC_Os08g31470.3 | upstream_gene_variant ; 2203.0bp to feature; MODIFIER | silent_mutation | Average:64.959; most accessible tissue: Zhenshan97 flower, score: 84.874 | N | N | N | N |
| vg0819463121 | C -> T | LOC_Os08g31460.1 | downstream_gene_variant ; 2679.0bp to feature; MODIFIER | silent_mutation | Average:64.959; most accessible tissue: Zhenshan97 flower, score: 84.874 | N | N | N | N |
| vg0819463121 | C -> T | LOC_Os08g31460-LOC_Os08g31470 | intergenic_region ; MODIFIER | silent_mutation | Average:64.959; most accessible tissue: Zhenshan97 flower, score: 84.874 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0819463121 | NA | 6.06E-07 | mr1073 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819463121 | NA | 1.54E-07 | mr1133 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819463121 | 6.70E-07 | 6.70E-07 | mr1413 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819463121 | 4.06E-06 | NA | mr1552 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819463121 | NA | 1.01E-08 | mr1552 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819463121 | NA | 5.72E-06 | mr1606 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819463121 | NA | 5.24E-06 | mr1667 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819463121 | NA | 5.55E-07 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819463121 | NA | 1.43E-08 | mr1852 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819463121 | NA | 3.63E-07 | mr1047_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819463121 | NA | 3.63E-07 | mr1063_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819463121 | NA | 2.67E-07 | mr1808_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |