Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819445057:

Variant ID: vg0819445057 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 19445057
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTGTAAAAGTATACCATTGAGGACCGTGTAAAAGGATTATAAGCCTTATAAGGACATAGGGAGTAATACAGAGAGAAAACAAGGGGAACGAAAAAAACT[A/G]
CAGGAGAAATTAGTGTTGTTTTGATAGGTAAAAACGAAAAGAAATAAAGAAAATAGTATTGAAGAGTTATAGTGGATCACTGTTGTGCTTATTTAGGGAT

Reverse complement sequence

ATCCCTAAATAAGCACAACAGTGATCCACTATAACTCTTCAATACTATTTTCTTTATTTCTTTTCGTTTTTACCTATCAAAACAACACTAATTTCTCCTG[T/C]
AGTTTTTTTCGTTCCCCTTGTTTTCTCTCTGTATTACTCCCTATGTCCTTATAAGGCTTATAATCCTTTTACACGGTCCTCAATGGTATACTTTTACAAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.70%	10.10%	0.06%	3.11%	NA
All Indica	2759	83.90%	10.80%	0.11%	5.26%	NA
All Japonica	1512	99.60%	0.30%	0.00%	0.13%	NA
Aus	269	40.50%	59.50%	0.00%	0.00%	NA
Indica I	595	83.40%	14.80%	0.00%	1.85%	NA
Indica II	465	95.90%	2.20%	0.00%	1.94%	NA
Indica III	913	76.10%	11.60%	0.33%	11.94%	NA
Indica Intermediate	786	86.10%	11.80%	0.00%	2.04%	NA
Temperate Japonica	767	99.70%	0.10%	0.00%	0.13%	NA
Tropical Japonica	504	99.60%	0.20%	0.00%	0.20%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	86.50%	13.50%	0.00%	0.00%	NA
Intermediate	90	96.70%	3.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0819445057	A -> G	LOC_Os08g31430.1	upstream_gene_variant ; 2413.0bp to feature; MODIFIER	silent_mutation	Average:29.053; most accessible tissue: Callus, score: 74.129	N	N	N	N
vg0819445057	A -> G	LOC_Os08g31440.1	upstream_gene_variant ; 762.0bp to feature; MODIFIER	silent_mutation	Average:29.053; most accessible tissue: Callus, score: 74.129	N	N	N	N
vg0819445057	A -> G	LOC_Os08g31430-LOC_Os08g31440	intergenic_region ; MODIFIER	silent_mutation	Average:29.053; most accessible tissue: Callus, score: 74.129	N	N	N	N
vg0819445057	A -> DEL	N	N	silent_mutation	Average:29.053; most accessible tissue: Callus, score: 74.129	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0819445057	1.54E-06	1.54E-06	mr1753_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819445057	NA	4.47E-07	mr1756_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819445057	NA	1.04E-06	mr1759_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819445057	9.28E-06	9.28E-06	mr1764_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819445057	NA	5.67E-06	mr1813_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819445057	NA	1.63E-06	mr1814_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819445057	NA	4.93E-06	mr1823_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819445057	NA	5.25E-07	mr1823_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819445057	NA	4.82E-06	mr1838_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819445057	NA	6.25E-06	mr1854_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819445057	NA	6.57E-06	mr1894_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819445057	NA	5.67E-06	mr1976_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819445057	9.43E-06	9.45E-06	mr1985_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251