\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819445057:

Variant ID: vg0819445057 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19445057
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTGTAAAAGTATACCATTGAGGACCGTGTAAAAGGATTATAAGCCTTATAAGGACATAGGGAGTAATACAGAGAGAAAACAAGGGGAACGAAAAAAACT[A/G]
CAGGAGAAATTAGTGTTGTTTTGATAGGTAAAAACGAAAAGAAATAAAGAAAATAGTATTGAAGAGTTATAGTGGATCACTGTTGTGCTTATTTAGGGAT

Reverse complement sequence

ATCCCTAAATAAGCACAACAGTGATCCACTATAACTCTTCAATACTATTTTCTTTATTTCTTTTCGTTTTTACCTATCAAAACAACACTAATTTCTCCTG[T/C]
AGTTTTTTTCGTTCCCCTTGTTTTCTCTCTGTATTACTCCCTATGTCCTTATAAGGCTTATAATCCTTTTACACGGTCCTCAATGGTATACTTTTACAAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.70% 10.10% 0.06% 3.11% NA
All Indica  2759 83.90% 10.80% 0.11% 5.26% NA
All Japonica  1512 99.60% 0.30% 0.00% 0.13% NA
Aus  269 40.50% 59.50% 0.00% 0.00% NA
Indica I  595 83.40% 14.80% 0.00% 1.85% NA
Indica II  465 95.90% 2.20% 0.00% 1.94% NA
Indica III  913 76.10% 11.60% 0.33% 11.94% NA
Indica Intermediate  786 86.10% 11.80% 0.00% 2.04% NA
Temperate Japonica  767 99.70% 0.10% 0.00% 0.13% NA
Tropical Japonica  504 99.60% 0.20% 0.00% 0.20% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 86.50% 13.50% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819445057 A -> G LOC_Os08g31430.1 upstream_gene_variant ; 2413.0bp to feature; MODIFIER silent_mutation Average:29.053; most accessible tissue: Callus, score: 74.129 N N N N
vg0819445057 A -> G LOC_Os08g31440.1 upstream_gene_variant ; 762.0bp to feature; MODIFIER silent_mutation Average:29.053; most accessible tissue: Callus, score: 74.129 N N N N
vg0819445057 A -> G LOC_Os08g31430-LOC_Os08g31440 intergenic_region ; MODIFIER silent_mutation Average:29.053; most accessible tissue: Callus, score: 74.129 N N N N
vg0819445057 A -> DEL N N silent_mutation Average:29.053; most accessible tissue: Callus, score: 74.129 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819445057 1.54E-06 1.54E-06 mr1753_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819445057 NA 4.47E-07 mr1756_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819445057 NA 1.04E-06 mr1759_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819445057 9.28E-06 9.28E-06 mr1764_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819445057 NA 5.67E-06 mr1813_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819445057 NA 1.63E-06 mr1814_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819445057 NA 4.93E-06 mr1823_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819445057 NA 5.25E-07 mr1823_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819445057 NA 4.82E-06 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819445057 NA 6.25E-06 mr1854_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819445057 NA 6.57E-06 mr1894_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819445057 NA 5.67E-06 mr1976_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819445057 9.43E-06 9.45E-06 mr1985_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251