\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819444873:

Variant ID: vg0819444873 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19444873
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.68, T: 0.32, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTATTACTTCCTCCATCCCAAATTATATGATATCCTTGTTTTTTTAAAAAATAATGATTGTAATAACAATATCTATGTAGATATTGTTAAGTATTATG[C/T]
ATGTTTTATCACTAGATTTATATCGATTTTTAAAAAAATTATGTAATATTATAGTTGTTGATAACATAATATAAATTAAATTAATTGTAAAAGTATACCA

Reverse complement sequence

TGGTATACTTTTACAATTAATTTAATTTATATTATGTTATCAACAACTATAATATTACATAATTTTTTTAAAAATCGATATAAATCTAGTGATAAAACAT[G/A]
CATAATACTTAACAATATCTACATAGATATTGTTATTACAATCATTATTTTTTAAAAAAACAAGGATATCATATAATTTGGGATGGAGGAAGTAATAAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.20% 33.20% 0.38% 3.26% NA
All Indica  2759 53.50% 40.50% 0.54% 5.51% NA
All Japonica  1512 82.90% 16.90% 0.13% 0.13% NA
Aus  269 40.90% 58.70% 0.37% 0.00% NA
Indica I  595 76.60% 21.30% 0.17% 1.85% NA
Indica II  465 86.50% 11.60% 0.22% 1.72% NA
Indica III  913 26.90% 59.40% 0.88% 12.81% NA
Indica Intermediate  786 47.20% 50.10% 0.64% 2.04% NA
Temperate Japonica  767 99.70% 0.10% 0.00% 0.13% NA
Tropical Japonica  504 54.60% 44.80% 0.40% 0.20% NA
Japonica Intermediate  241 88.40% 11.60% 0.00% 0.00% NA
VI/Aromatic  96 81.20% 18.80% 0.00% 0.00% NA
Intermediate  90 77.80% 22.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819444873 C -> T LOC_Os08g31430.1 upstream_gene_variant ; 2229.0bp to feature; MODIFIER silent_mutation Average:22.545; most accessible tissue: Callus, score: 49.207 N N N N
vg0819444873 C -> T LOC_Os08g31440.1 upstream_gene_variant ; 946.0bp to feature; MODIFIER silent_mutation Average:22.545; most accessible tissue: Callus, score: 49.207 N N N N
vg0819444873 C -> T LOC_Os08g31430-LOC_Os08g31440 intergenic_region ; MODIFIER silent_mutation Average:22.545; most accessible tissue: Callus, score: 49.207 N N N N
vg0819444873 C -> DEL N N silent_mutation Average:22.545; most accessible tissue: Callus, score: 49.207 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819444873 NA 3.78E-06 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819444873 NA 6.71E-06 mr1073 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819444873 NA 3.25E-07 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819444873 NA 2.43E-06 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819444873 NA 1.65E-06 mr1870 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819444873 NA 1.36E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819444873 NA 8.74E-07 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819444873 NA 6.95E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819444873 NA 8.83E-06 mr1291_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819444873 NA 6.44E-06 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819444873 NA 5.91E-06 mr1580_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819444873 NA 7.42E-07 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819444873 NA 2.38E-06 mr1756_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819444873 NA 1.83E-07 mr1759_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819444873 NA 6.91E-08 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819444873 NA 9.30E-06 mr1814_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819444873 NA 3.53E-06 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819444873 NA 1.22E-07 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819444873 NA 8.70E-06 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819444873 2.71E-07 2.72E-07 mr1985_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251