\
| Variant ID: vg0819439794 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 19439794 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.51, A: 0.49, others allele: 0.00, population size: 100. )
CTAAGGGGTATCTCTTTCCTTGCAGAGGCGAGATCCGGCCTTCACAAACTTCTCCCGGCCAACCACACGTAGATCGGTGGCTCGGGAGTGACACCTAGCC[A/G]
TCTAGGAGTCCTCAACCTCCAAGAGTAACAAACACCACACAACTCTTGGTCAAACCCTAGTGCTTAAGATCGAGTGAAACACACACTAGGTCCTCAAATA
TATTTGAGGACCTAGTGTGTGTTTCACTCGATCTTAAGCACTAGGGTTTGACCAAGAGTTGTGTGGTGTTTGTTACTCTTGGAGGTTGAGGACTCCTAGA[T/C]
GGCTAGGTGTCACTCCCGAGCCACCGATCTACGTGTGGTTGGCCGGGAGAAGTTTGTGAAGGCCGGATCTCGCCTCTGCAAGGAAAGAGATACCCCTTAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.70% | 31.40% | 12.46% | 18.43% | NA |
| All Indica | 2759 | 14.30% | 36.10% | 18.96% | 30.63% | NA |
| All Japonica | 1512 | 81.70% | 16.90% | 0.73% | 0.66% | NA |
| Aus | 269 | 12.60% | 71.00% | 15.24% | 1.12% | NA |
| Indica I | 595 | 7.70% | 19.20% | 28.91% | 44.20% | NA |
| Indica II | 465 | 7.50% | 11.40% | 22.58% | 58.49% | NA |
| Indica III | 913 | 25.70% | 51.70% | 10.73% | 11.83% | NA |
| Indica Intermediate | 786 | 10.10% | 45.40% | 18.83% | 25.70% | NA |
| Temperate Japonica | 767 | 99.30% | 0.10% | 0.00% | 0.52% | NA |
| Tropical Japonica | 504 | 52.80% | 45.00% | 1.59% | 0.60% | NA |
| Japonica Intermediate | 241 | 86.30% | 11.20% | 1.24% | 1.24% | NA |
| VI/Aromatic | 96 | 77.10% | 22.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 46.70% | 23.30% | 15.56% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0819439794 | A -> G | LOC_Os08g31420.1 | upstream_gene_variant ; 2324.0bp to feature; MODIFIER | silent_mutation | Average:15.797; most accessible tissue: Callus, score: 25.29 | N | N | N | N |
| vg0819439794 | A -> G | LOC_Os08g31430.1 | downstream_gene_variant ; 1444.0bp to feature; MODIFIER | silent_mutation | Average:15.797; most accessible tissue: Callus, score: 25.29 | N | N | N | N |
| vg0819439794 | A -> G | LOC_Os08g31420-LOC_Os08g31430 | intergenic_region ; MODIFIER | silent_mutation | Average:15.797; most accessible tissue: Callus, score: 25.29 | N | N | N | N |
| vg0819439794 | A -> DEL | N | N | silent_mutation | Average:15.797; most accessible tissue: Callus, score: 25.29 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0819439794 | NA | 3.18E-06 | mr1063 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819439794 | 3.61E-06 | 1.16E-07 | mr1041_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819439794 | 5.73E-07 | 5.72E-07 | mr1061_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819439794 | NA | 6.93E-07 | mr1063_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819439794 | NA | 5.40E-06 | mr1078_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819439794 | NA | 1.96E-06 | mr1159_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819439794 | NA | 9.80E-06 | mr1177_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819439794 | NA | 4.97E-07 | mr1211_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819439794 | NA | 9.07E-09 | mr1252_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819439794 | NA | 1.93E-06 | mr1263_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819439794 | 7.66E-06 | 2.61E-06 | mr1283_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819439794 | NA | 7.40E-06 | mr1293_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819439794 | 9.03E-06 | 4.29E-08 | mr1294_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819439794 | NA | 1.26E-08 | mr1299_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819439794 | 1.36E-06 | 1.36E-06 | mr1382_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819439794 | 1.83E-06 | 1.82E-06 | mr1412_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819439794 | NA | 8.45E-06 | mr1466_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819439794 | NA | 2.70E-07 | mr1482_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819439794 | NA | 1.90E-08 | mr1494_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819439794 | NA | 2.45E-06 | mr1497_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819439794 | NA | 6.49E-06 | mr1505_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819439794 | 9.48E-06 | NA | mr1604_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819439794 | NA | 2.44E-06 | mr1638_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819439794 | NA | 9.60E-08 | mr1700_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819439794 | NA | 7.13E-06 | mr1702_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819439794 | 1.01E-06 | 1.25E-08 | mr1727_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819439794 | NA | 7.42E-08 | mr1729_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819439794 | NA | 9.74E-07 | mr1736_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819439794 | NA | 5.07E-07 | mr1740_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819439794 | NA | 1.96E-10 | mr1741_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819439794 | 5.42E-06 | NA | mr1751_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819439794 | 9.66E-06 | 9.63E-06 | mr1752_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819439794 | NA | 7.84E-06 | mr1756_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819439794 | 1.18E-06 | 4.41E-09 | mr1759_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819439794 | NA | 2.48E-07 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819439794 | NA | 9.94E-07 | mr1813_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819439794 | NA | 9.78E-09 | mr1814_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819439794 | NA | 2.89E-06 | mr1823_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819439794 | NA | 9.03E-06 | mr1831_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819439794 | 4.42E-06 | NA | mr1838_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819439794 | NA | 5.95E-06 | mr1840_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819439794 | NA | 8.28E-07 | mr1854_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819439794 | NA | 1.10E-06 | mr1856_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819439794 | NA | 1.95E-06 | mr1876_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819439794 | NA | 2.95E-06 | mr1882_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819439794 | NA | 2.71E-07 | mr1894_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819439794 | 5.79E-07 | 1.12E-07 | mr1976_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819439794 | 1.99E-06 | 1.99E-06 | mr1985_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |