\
| Variant ID: vg0819433740 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 19433740 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 313. )
TCCTCATATCTATCTTCTCCCGGATCCGCTTCTTCCCTCACTTATGTATTTTTCTTTTCTACTGAGCATGGCTCCGTCCTCCTCCCTCCATCAACTTCTC[C/T]
AGCCCAATAGCTGGAGGACCAATCCATGTCCTCCTCCTCCTCCCTCCCTCGACTCCTCGATCATCATCACCAACGCCAACGATATCCCCTATCATCTTTC
GAAAGATGATAGGGGATATCGTTGGCGTTGGTGATGATGATCGAGGAGTCGAGGGAGGGAGGAGGAGGAGGACATGGATTGGTCCTCCAGCTATTGGGCT[G/A]
GAGAAGTTGATGGAGGGAGGAGGACGGAGCCATGCTCAGTAGAAAAGAAAAATACATAAGTGAGGGAAGAAGCGGATCCGGGAGAAGATAGATATGAGGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.70% | 1.60% | 1.65% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.00% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 90.30% | 5.00% | 4.70% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 84.70% | 8.30% | 6.91% | 0.00% | NA |
| Tropical Japonica | 504 | 97.80% | 0.40% | 1.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 92.10% | 4.10% | 3.73% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 1.10% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0819433740 | C -> T | LOC_Os08g31410.1 | downstream_gene_variant ; 1032.0bp to feature; MODIFIER | silent_mutation | Average:60.748; most accessible tissue: Zhenshan97 young leaf, score: 87.584 | N | N | N | N |
| vg0819433740 | C -> T | LOC_Os08g31420.1 | downstream_gene_variant ; 2318.0bp to feature; MODIFIER | silent_mutation | Average:60.748; most accessible tissue: Zhenshan97 young leaf, score: 87.584 | N | N | N | N |
| vg0819433740 | C -> T | LOC_Os08g31410.7 | downstream_gene_variant ; 1032.0bp to feature; MODIFIER | silent_mutation | Average:60.748; most accessible tissue: Zhenshan97 young leaf, score: 87.584 | N | N | N | N |
| vg0819433740 | C -> T | LOC_Os08g31410.4 | downstream_gene_variant ; 1032.0bp to feature; MODIFIER | silent_mutation | Average:60.748; most accessible tissue: Zhenshan97 young leaf, score: 87.584 | N | N | N | N |
| vg0819433740 | C -> T | LOC_Os08g31410.5 | downstream_gene_variant ; 1032.0bp to feature; MODIFIER | silent_mutation | Average:60.748; most accessible tissue: Zhenshan97 young leaf, score: 87.584 | N | N | N | N |
| vg0819433740 | C -> T | LOC_Os08g31410.6 | downstream_gene_variant ; 1032.0bp to feature; MODIFIER | silent_mutation | Average:60.748; most accessible tissue: Zhenshan97 young leaf, score: 87.584 | N | N | N | N |
| vg0819433740 | C -> T | LOC_Os08g31410.3 | downstream_gene_variant ; 1032.0bp to feature; MODIFIER | silent_mutation | Average:60.748; most accessible tissue: Zhenshan97 young leaf, score: 87.584 | N | N | N | N |
| vg0819433740 | C -> T | LOC_Os08g31410.2 | downstream_gene_variant ; 1032.0bp to feature; MODIFIER | silent_mutation | Average:60.748; most accessible tissue: Zhenshan97 young leaf, score: 87.584 | N | N | N | N |
| vg0819433740 | C -> T | LOC_Os08g31410-LOC_Os08g31420 | intergenic_region ; MODIFIER | silent_mutation | Average:60.748; most accessible tissue: Zhenshan97 young leaf, score: 87.584 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0819433740 | 1.29E-07 | 1.29E-07 | mr1015_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819433740 | 4.33E-06 | 5.30E-06 | mr1071_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819433740 | 2.65E-07 | 8.80E-07 | mr1100_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819433740 | 6.73E-06 | NA | mr1203_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819433740 | 3.90E-08 | 9.58E-08 | mr1613_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819433740 | 2.03E-07 | 5.36E-07 | mr1619_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819433740 | NA | 6.06E-06 | mr1795_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819433740 | 2.01E-06 | 8.79E-07 | mr1913_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |