\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819433740:

Variant ID: vg0819433740 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19433740
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:


TCCTCATATCTATCTTCTCCCGGATCCGCTTCTTCCCTCACTTATGTATTTTTCTTTTCTACTGAGCATGGCTCCGTCCTCCTCCCTCCATCAACTTCTC[C/T]
AGCCCAATAGCTGGAGGACCAATCCATGTCCTCCTCCTCCTCCCTCCCTCGACTCCTCGATCATCATCACCAACGCCAACGATATCCCCTATCATCTTTC

Reverse complement sequence

GAAAGATGATAGGGGATATCGTTGGCGTTGGTGATGATGATCGAGGAGTCGAGGGAGGGAGGAGGAGGAGGACATGGATTGGTCCTCCAGCTATTGGGCT[G/A]
GAGAAGTTGATGGAGGGAGGAGGACGGAGCCATGCTCAGTAGAAAAGAAAAATACATAAGTGAGGGAAGAAGCGGATCCGGGAGAAGATAGATATGAGGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.70% 1.60% 1.65% 0.00% NA
All Indica  2759 99.90% 0.00% 0.07% 0.00% NA
All Japonica  1512 90.30% 5.00% 4.70% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.00% 0.13% 0.00% NA
Temperate Japonica  767 84.70% 8.30% 6.91% 0.00% NA
Tropical Japonica  504 97.80% 0.40% 1.79% 0.00% NA
Japonica Intermediate  241 92.10% 4.10% 3.73% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 94.40% 1.10% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819433740 C -> T LOC_Os08g31410.1 downstream_gene_variant ; 1032.0bp to feature; MODIFIER silent_mutation Average:60.748; most accessible tissue: Zhenshan97 young leaf, score: 87.584 N N N N
vg0819433740 C -> T LOC_Os08g31420.1 downstream_gene_variant ; 2318.0bp to feature; MODIFIER silent_mutation Average:60.748; most accessible tissue: Zhenshan97 young leaf, score: 87.584 N N N N
vg0819433740 C -> T LOC_Os08g31410.7 downstream_gene_variant ; 1032.0bp to feature; MODIFIER silent_mutation Average:60.748; most accessible tissue: Zhenshan97 young leaf, score: 87.584 N N N N
vg0819433740 C -> T LOC_Os08g31410.4 downstream_gene_variant ; 1032.0bp to feature; MODIFIER silent_mutation Average:60.748; most accessible tissue: Zhenshan97 young leaf, score: 87.584 N N N N
vg0819433740 C -> T LOC_Os08g31410.5 downstream_gene_variant ; 1032.0bp to feature; MODIFIER silent_mutation Average:60.748; most accessible tissue: Zhenshan97 young leaf, score: 87.584 N N N N
vg0819433740 C -> T LOC_Os08g31410.6 downstream_gene_variant ; 1032.0bp to feature; MODIFIER silent_mutation Average:60.748; most accessible tissue: Zhenshan97 young leaf, score: 87.584 N N N N
vg0819433740 C -> T LOC_Os08g31410.3 downstream_gene_variant ; 1032.0bp to feature; MODIFIER silent_mutation Average:60.748; most accessible tissue: Zhenshan97 young leaf, score: 87.584 N N N N
vg0819433740 C -> T LOC_Os08g31410.2 downstream_gene_variant ; 1032.0bp to feature; MODIFIER silent_mutation Average:60.748; most accessible tissue: Zhenshan97 young leaf, score: 87.584 N N N N
vg0819433740 C -> T LOC_Os08g31410-LOC_Os08g31420 intergenic_region ; MODIFIER silent_mutation Average:60.748; most accessible tissue: Zhenshan97 young leaf, score: 87.584 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819433740 1.29E-07 1.29E-07 mr1015_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819433740 4.33E-06 5.30E-06 mr1071_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819433740 2.65E-07 8.80E-07 mr1100_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819433740 6.73E-06 NA mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819433740 3.90E-08 9.58E-08 mr1613_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819433740 2.03E-07 5.36E-07 mr1619_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819433740 NA 6.06E-06 mr1795_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819433740 2.01E-06 8.79E-07 mr1913_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251