\
| Variant ID: vg0819431872 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 19431872 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TGAACATATAGCCTCATGACATTTATCTGGTCCATTTCAGAACTCTTAGGTGGTTGACGGAGGAAGAAGAGAAAGCCAAAGCAGAGGGACAGTCTAAAAT[C/T]
AATTTCTTGATCATAGAGATGTCCCGTAAGTTTTAGTGATTTAGTGGTCTCGTATCATAATTCATAAATTAAGTTTATCACTTATTGAGCTGATACAAAT
ATTTGTATCAGCTCAATAAGTGATAAACTTAATTTATGAATTATGATACGAGACCACTAAATCACTAAAACTTACGGGACATCTCTATGATCAAGAAATT[G/A]
ATTTTAGACTGTCCCTCTGCTTTGGCTTTCTCTTCTTCCTCCGTCAACCACCTAAGAGTTCTGAAATGGACCAGATAAATGTCATGAGGCTATATGTTCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.60% | 1.30% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 95.80% | 4.00% | 0.26% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 92.40% | 7.40% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 1.20% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0819431872 | C -> T | LOC_Os08g31410.1 | synonymous_variant ; p.Ile575Ile; LOW | synonymous_codon | Average:47.209; most accessible tissue: Minghui63 young leaf, score: 68.745 | N | N | N | N |
| vg0819431872 | C -> T | LOC_Os08g31410.7 | synonymous_variant ; p.Ile575Ile; LOW | synonymous_codon | Average:47.209; most accessible tissue: Minghui63 young leaf, score: 68.745 | N | N | N | N |
| vg0819431872 | C -> T | LOC_Os08g31410.4 | synonymous_variant ; p.Ile575Ile; LOW | synonymous_codon | Average:47.209; most accessible tissue: Minghui63 young leaf, score: 68.745 | N | N | N | N |
| vg0819431872 | C -> T | LOC_Os08g31410.5 | synonymous_variant ; p.Ile575Ile; LOW | synonymous_codon | Average:47.209; most accessible tissue: Minghui63 young leaf, score: 68.745 | N | N | N | N |
| vg0819431872 | C -> T | LOC_Os08g31410.6 | synonymous_variant ; p.Ile575Ile; LOW | synonymous_codon | Average:47.209; most accessible tissue: Minghui63 young leaf, score: 68.745 | N | N | N | N |
| vg0819431872 | C -> T | LOC_Os08g31410.3 | synonymous_variant ; p.Ile575Ile; LOW | synonymous_codon | Average:47.209; most accessible tissue: Minghui63 young leaf, score: 68.745 | N | N | N | N |
| vg0819431872 | C -> T | LOC_Os08g31410.2 | synonymous_variant ; p.Ile575Ile; LOW | synonymous_codon | Average:47.209; most accessible tissue: Minghui63 young leaf, score: 68.745 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0819431872 | 4.80E-07 | 4.80E-07 | mr1197 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819431872 | 3.27E-07 | 3.27E-07 | mr1245_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819431872 | NA | 7.99E-06 | mr1267_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819431872 | 8.93E-06 | 8.93E-06 | mr1360_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819431872 | 4.22E-07 | 4.22E-07 | mr1371_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819431872 | 8.71E-08 | 8.71E-08 | mr1445_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819431872 | 2.08E-06 | 2.08E-06 | mr1647_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819431872 | 4.88E-07 | 4.88E-07 | mr1655_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819431872 | 4.89E-06 | 4.89E-06 | mr1669_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819431872 | 5.68E-06 | 5.68E-06 | mr1697_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |