\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819431872:

Variant ID: vg0819431872 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19431872
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGAACATATAGCCTCATGACATTTATCTGGTCCATTTCAGAACTCTTAGGTGGTTGACGGAGGAAGAAGAGAAAGCCAAAGCAGAGGGACAGTCTAAAAT[C/T]
AATTTCTTGATCATAGAGATGTCCCGTAAGTTTTAGTGATTTAGTGGTCTCGTATCATAATTCATAAATTAAGTTTATCACTTATTGAGCTGATACAAAT

Reverse complement sequence

ATTTGTATCAGCTCAATAAGTGATAAACTTAATTTATGAATTATGATACGAGACCACTAAATCACTAAAACTTACGGGACATCTCTATGATCAAGAAATT[G/A]
ATTTTAGACTGTCCCTCTGCTTTGGCTTTCTCTTCTTCCTCCGTCAACCACCTAAGAGTTCTGAAATGGACCAGATAAATGTCATGAGGCTATATGTTCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.60% 1.30% 0.08% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 95.80% 4.00% 0.26% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 92.40% 7.40% 0.13% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 1.20% 1.24% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819431872 C -> T LOC_Os08g31410.1 synonymous_variant ; p.Ile575Ile; LOW synonymous_codon Average:47.209; most accessible tissue: Minghui63 young leaf, score: 68.745 N N N N
vg0819431872 C -> T LOC_Os08g31410.7 synonymous_variant ; p.Ile575Ile; LOW synonymous_codon Average:47.209; most accessible tissue: Minghui63 young leaf, score: 68.745 N N N N
vg0819431872 C -> T LOC_Os08g31410.4 synonymous_variant ; p.Ile575Ile; LOW synonymous_codon Average:47.209; most accessible tissue: Minghui63 young leaf, score: 68.745 N N N N
vg0819431872 C -> T LOC_Os08g31410.5 synonymous_variant ; p.Ile575Ile; LOW synonymous_codon Average:47.209; most accessible tissue: Minghui63 young leaf, score: 68.745 N N N N
vg0819431872 C -> T LOC_Os08g31410.6 synonymous_variant ; p.Ile575Ile; LOW synonymous_codon Average:47.209; most accessible tissue: Minghui63 young leaf, score: 68.745 N N N N
vg0819431872 C -> T LOC_Os08g31410.3 synonymous_variant ; p.Ile575Ile; LOW synonymous_codon Average:47.209; most accessible tissue: Minghui63 young leaf, score: 68.745 N N N N
vg0819431872 C -> T LOC_Os08g31410.2 synonymous_variant ; p.Ile575Ile; LOW synonymous_codon Average:47.209; most accessible tissue: Minghui63 young leaf, score: 68.745 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819431872 4.80E-07 4.80E-07 mr1197 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819431872 3.27E-07 3.27E-07 mr1245_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819431872 NA 7.99E-06 mr1267_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819431872 8.93E-06 8.93E-06 mr1360_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819431872 4.22E-07 4.22E-07 mr1371_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819431872 8.71E-08 8.71E-08 mr1445_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819431872 2.08E-06 2.08E-06 mr1647_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819431872 4.88E-07 4.88E-07 mr1655_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819431872 4.89E-06 4.89E-06 mr1669_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819431872 5.68E-06 5.68E-06 mr1697_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251