Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819426996:

Variant ID: vg0819426996 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 19426996
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:

TGGTTCATAGATCAACATTGTCCAAGGTTATCATAATTTTCTAACAAGCTTGCTTCAGATTATACGAACAAATTTGACATCACACTTTTACTAGCAAGCC[A/G]
CAACCCACCACGCTTTTTTAAACAATAATGTGTGAGGTTAAAGTGTTAGAAGAAAGATTTTATCATAAGTGTAACCATGAACCAAACGCATAATAAAGTT

Reverse complement sequence

AACTTTATTATGCGTTTGGTTCATGGTTACACTTATGATAAAATCTTTCTTCTAACACTTTAACCTCACACATTATTGTTTAAAAAAGCGTGGTGGGTTG[T/C]
GGCTTGCTAGTAAAAGTGTGATGTCAAATTTGTTCGTATAATCTGAAGCAAGCTTGTTAGAAAATTATGATAACCTTGGACAATGTTGATCTATGAACCA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.60%	7.90%	1.50%	0.00%	NA
All Indica	2759	90.50%	7.00%	2.57%	0.00%	NA
All Japonica	1512	99.80%	0.20%	0.00%	0.00%	NA
Aus	269	40.10%	59.90%	0.00%	0.00%	NA
Indica I	595	73.80%	16.30%	9.92%	0.00%	NA
Indica II	465	94.40%	4.50%	1.08%	0.00%	NA
Indica III	913	98.10%	1.80%	0.11%	0.00%	NA
Indica Intermediate	786	91.90%	7.40%	0.76%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	86.50%	13.50%	0.00%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0819426996	A -> G	LOC_Os08g31410.1	upstream_gene_variant ; 459.0bp to feature; MODIFIER	silent_mutation	Average:86.492; most accessible tissue: Callus, score: 96.43	N	N	N	N
vg0819426996	A -> G	LOC_Os08g31410.7	upstream_gene_variant ; 427.0bp to feature; MODIFIER	silent_mutation	Average:86.492; most accessible tissue: Callus, score: 96.43	N	N	N	N
vg0819426996	A -> G	LOC_Os08g31410.4	upstream_gene_variant ; 446.0bp to feature; MODIFIER	silent_mutation	Average:86.492; most accessible tissue: Callus, score: 96.43	N	N	N	N
vg0819426996	A -> G	LOC_Os08g31410.5	upstream_gene_variant ; 446.0bp to feature; MODIFIER	silent_mutation	Average:86.492; most accessible tissue: Callus, score: 96.43	N	N	N	N
vg0819426996	A -> G	LOC_Os08g31410.6	upstream_gene_variant ; 446.0bp to feature; MODIFIER	silent_mutation	Average:86.492; most accessible tissue: Callus, score: 96.43	N	N	N	N
vg0819426996	A -> G	LOC_Os08g31410.3	upstream_gene_variant ; 450.0bp to feature; MODIFIER	silent_mutation	Average:86.492; most accessible tissue: Callus, score: 96.43	N	N	N	N
vg0819426996	A -> G	LOC_Os08g31410.2	upstream_gene_variant ; 459.0bp to feature; MODIFIER	silent_mutation	Average:86.492; most accessible tissue: Callus, score: 96.43	N	N	N	N
vg0819426996	A -> G	LOC_Os08g31400-LOC_Os08g31410	intergenic_region ; MODIFIER	silent_mutation	Average:86.492; most accessible tissue: Callus, score: 96.43	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0819426996	1.34E-06	1.35E-06	mr1468_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819426996	NA	3.07E-07	mr1528_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251