\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819421680:

Variant ID: vg0819421680 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19421680
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGAGCCGATGCATCGAGCCGGCGCTTTTTTATTCGTGAAACCTTAATGGTGCCGGTTCTAAAACATAAAAAACCAACATCTTTACCCATATAGATGCCGG[T/G]
TCTAAAACCAGCACCAATGACCGAAGTCATCAGTGATGTCTCCGTTGTGCCAGTTGGAAAAACCGGCACCTAAGGAGATTTCCAACCAGCACCGATTAGC

Reverse complement sequence

GCTAATCGGTGCTGGTTGGAAATCTCCTTAGGTGCCGGTTTTTCCAACTGGCACAACGGAGACATCACTGATGACTTCGGTCATTGGTGCTGGTTTTAGA[A/C]
CCGGCATCTATATGGGTAAAGATGTTGGTTTTTTATGTTTTAGAACCGGCACCATTAAGGTTTCACGAATAAAAAAGCGCCGGCTCGATGCATCGGCTCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.80% 2.60% 2.12% 1.50% NA
All Indica  2759 96.60% 0.00% 0.83% 2.57% NA
All Japonica  1512 86.90% 8.10% 5.03% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.00% 0.00% 0.22% NA
Indica III  913 91.10% 0.00% 2.30% 6.57% NA
Indica Intermediate  786 98.50% 0.00% 0.25% 1.27% NA
Temperate Japonica  767 88.10% 5.30% 6.52% 0.00% NA
Tropical Japonica  504 96.60% 2.60% 0.79% 0.00% NA
Japonica Intermediate  241 62.70% 28.20% 9.13% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 1.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819421680 T -> G LOC_Os08g31400-LOC_Os08g31410 intergenic_region ; MODIFIER silent_mutation Average:52.06; most accessible tissue: Callus, score: 71.391 N N N N
vg0819421680 T -> DEL N N silent_mutation Average:52.06; most accessible tissue: Callus, score: 71.391 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819421680 1.96E-06 1.96E-06 mr1098 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819421680 1.15E-06 4.21E-07 mr1101 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819421680 6.81E-06 5.00E-06 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819421680 NA 5.11E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819421680 2.37E-08 1.33E-08 mr1247 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819421680 4.32E-06 4.04E-06 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819421680 NA 8.04E-06 mr1858 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819421680 NA 8.04E-06 mr1859 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819421680 3.88E-07 2.60E-07 mr1917 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819421680 3.82E-06 5.35E-06 mr1936 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819421680 1.71E-06 1.22E-07 mr1098_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819421680 NA 1.55E-06 mr1099_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819421680 2.64E-06 1.62E-06 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819421680 1.59E-07 1.15E-07 mr1114_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819421680 2.04E-08 1.76E-08 mr1117_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819421680 8.07E-06 NA mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819421680 5.31E-07 1.99E-07 mr1119_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819421680 1.32E-08 4.52E-09 mr1120_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819421680 1.56E-08 2.15E-08 mr1123_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819421680 NA 5.11E-06 mr1150_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819421680 3.48E-08 1.11E-08 mr1240_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819421680 2.41E-06 4.26E-06 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819421680 1.28E-07 2.46E-08 mr1247_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819421680 2.60E-06 2.20E-06 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819421680 2.64E-07 1.13E-06 mr1936_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251