Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819393368:

Variant ID: vg0819393368 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 19393368
Reference Allele: G	Alternative Allele: A,T
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

TCCGACCTTAACAAGGTTCCACTTCCTGCTTTCGTCCAAGACACTCTTGGAACAATGCAGGCAGCGAAACCTTGTATGGGTCGGAAAGAACGGCCTTAAG[G/A,T]
AACGTCGAGCTCCTGGTCTATCCACGAGGCCGACGCATGTACGAGTCAGAGGTCTATCTTTCAATAGACGTGCTAGCACATTTTACAGATGACCAACACA

Reverse complement sequence

TGTGTTGGTCATCTGTAAAATGTGCTAGCACGTCTATTGAAAGATAGACCTCTGACTCGTACATGCGTCGGCCTCGTGGATAGACCAGGAGCTCGACGTT[C/T,A]
CTTAAGGCCGTTCTTTCCGACCCATACAAGGTTTCGCTGCCTGCATTGTTCCAAGAGTGTCTTGGACGAAAGCAGGAAGTGGAACCTTGTTAAGGTCGGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.90%	26.00%	2.07%	33.09%	NA
All Indica	2759	12.30%	37.70%	2.79%	47.15%	NA
All Japonica	1512	72.60%	11.20%	1.12%	15.08%	NA
Aus	269	98.50%	0.40%	0.37%	0.74%	NA
Indica I	595	12.40%	33.40%	2.18%	51.93%	NA
Indica II	465	4.10%	28.00%	2.37%	65.59%	NA
Indica III	913	15.30%	46.90%	3.61%	34.17%	NA
Indica Intermediate	786	13.60%	36.10%	2.54%	47.71%	NA
Temperate Japonica	767	95.00%	0.10%	0.13%	4.69%	NA
Tropical Japonica	504	39.50%	30.40%	2.38%	27.78%	NA
Japonica Intermediate	241	70.10%	6.60%	1.66%	21.58%	NA
VI/Aromatic	96	92.70%	1.00%	2.08%	4.17%	NA
Intermediate	90	51.10%	15.60%	1.11%	32.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0819393368	G -> T	LOC_Os08g31350.1	upstream_gene_variant ; 327.0bp to feature; MODIFIER	N	Average:11.883; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N
vg0819393368	G -> T	LOC_Os08g31360.1	upstream_gene_variant ; 1808.0bp to feature; MODIFIER	N	Average:11.883; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N
vg0819393368	G -> T	LOC_Os08g31370.1	downstream_gene_variant ; 3062.0bp to feature; MODIFIER	N	Average:11.883; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N
vg0819393368	G -> T	LOC_Os08g31350-LOC_Os08g31360	intergenic_region ; MODIFIER	N	Average:11.883; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N
vg0819393368	G -> A	LOC_Os08g31350.1	upstream_gene_variant ; 327.0bp to feature; MODIFIER	silent_mutation	Average:11.883; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N
vg0819393368	G -> A	LOC_Os08g31360.1	upstream_gene_variant ; 1808.0bp to feature; MODIFIER	silent_mutation	Average:11.883; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N
vg0819393368	G -> A	LOC_Os08g31370.1	downstream_gene_variant ; 3062.0bp to feature; MODIFIER	silent_mutation	Average:11.883; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N
vg0819393368	G -> A	LOC_Os08g31350-LOC_Os08g31360	intergenic_region ; MODIFIER	silent_mutation	Average:11.883; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N
vg0819393368	G -> DEL	N	N	silent_mutation	Average:11.883; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0819393368	NA	5.00E-09	mr1352	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368	NA	7.24E-19	mr1422	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368	NA	2.56E-17	mr1583	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368	NA	1.71E-08	mr1852	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368	NA	2.33E-06	mr1159_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368	1.20E-06	1.20E-06	mr1284_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368	1.36E-06	1.36E-06	mr1286_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368	NA	5.74E-07	mr1299_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368	NA	1.08E-17	mr1352_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368	2.00E-08	2.00E-08	mr1412_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368	5.56E-09	5.56E-09	mr1417_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368	NA	2.07E-24	mr1422_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368	2.36E-08	6.36E-09	mr1467_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368	7.02E-07	7.02E-07	mr1485_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368	7.55E-07	7.55E-07	mr1488_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368	2.53E-08	8.63E-09	mr1556_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368	NA	4.47E-06	mr1633_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368	9.43E-07	9.43E-07	mr1665_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368	NA	1.29E-06	mr1683_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368	3.81E-07	3.81E-07	mr1687_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368	NA	3.31E-07	mr1700_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368	7.02E-06	7.02E-06	mr1727_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368	3.84E-07	3.84E-07	mr1747_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368	2.58E-06	2.58E-06	mr1753_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368	NA	5.75E-07	mr1756_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368	5.94E-07	7.53E-09	mr1759_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368	2.59E-08	2.59E-08	mr1764_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368	NA	4.68E-06	mr1779_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368	1.36E-07	2.30E-08	mr1811_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368	1.84E-06	1.84E-06	mr1812_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368	3.47E-07	3.47E-07	mr1816_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368	3.61E-09	8.81E-11	mr1823_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368	1.98E-06	1.79E-07	mr1824_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368	1.53E-08	2.09E-09	mr1831_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368	5.68E-06	5.67E-06	mr1832_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368	9.33E-06	9.33E-06	mr1833_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368	NA	9.50E-07	mr1838_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368	1.68E-07	1.68E-07	mr1840_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368	NA	1.11E-06	mr1854_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368	2.45E-07	1.11E-08	mr1856_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368	NA	4.65E-06	mr1976_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368	3.16E-06	9.17E-07	mr1985_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251