\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819393368:

Variant ID: vg0819393368 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19393368
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


TCCGACCTTAACAAGGTTCCACTTCCTGCTTTCGTCCAAGACACTCTTGGAACAATGCAGGCAGCGAAACCTTGTATGGGTCGGAAAGAACGGCCTTAAG[G/A,T]
AACGTCGAGCTCCTGGTCTATCCACGAGGCCGACGCATGTACGAGTCAGAGGTCTATCTTTCAATAGACGTGCTAGCACATTTTACAGATGACCAACACA

Reverse complement sequence

TGTGTTGGTCATCTGTAAAATGTGCTAGCACGTCTATTGAAAGATAGACCTCTGACTCGTACATGCGTCGGCCTCGTGGATAGACCAGGAGCTCGACGTT[C/T,A]
CTTAAGGCCGTTCTTTCCGACCCATACAAGGTTTCGCTGCCTGCATTGTTCCAAGAGTGTCTTGGACGAAAGCAGGAAGTGGAACCTTGTTAAGGTCGGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.90% 26.00% 2.07% 33.09% NA
All Indica  2759 12.30% 37.70% 2.79% 47.15% NA
All Japonica  1512 72.60% 11.20% 1.12% 15.08% NA
Aus  269 98.50% 0.40% 0.37% 0.74% NA
Indica I  595 12.40% 33.40% 2.18% 51.93% NA
Indica II  465 4.10% 28.00% 2.37% 65.59% NA
Indica III  913 15.30% 46.90% 3.61% 34.17% NA
Indica Intermediate  786 13.60% 36.10% 2.54% 47.71% NA
Temperate Japonica  767 95.00% 0.10% 0.13% 4.69% NA
Tropical Japonica  504 39.50% 30.40% 2.38% 27.78% NA
Japonica Intermediate  241 70.10% 6.60% 1.66% 21.58% NA
VI/Aromatic  96 92.70% 1.00% 2.08% 4.17% NA
Intermediate  90 51.10% 15.60% 1.11% 32.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819393368 G -> T LOC_Os08g31350.1 upstream_gene_variant ; 327.0bp to feature; MODIFIER N Average:11.883; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg0819393368 G -> T LOC_Os08g31360.1 upstream_gene_variant ; 1808.0bp to feature; MODIFIER N Average:11.883; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg0819393368 G -> T LOC_Os08g31370.1 downstream_gene_variant ; 3062.0bp to feature; MODIFIER N Average:11.883; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg0819393368 G -> T LOC_Os08g31350-LOC_Os08g31360 intergenic_region ; MODIFIER N Average:11.883; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg0819393368 G -> A LOC_Os08g31350.1 upstream_gene_variant ; 327.0bp to feature; MODIFIER silent_mutation Average:11.883; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg0819393368 G -> A LOC_Os08g31360.1 upstream_gene_variant ; 1808.0bp to feature; MODIFIER silent_mutation Average:11.883; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg0819393368 G -> A LOC_Os08g31370.1 downstream_gene_variant ; 3062.0bp to feature; MODIFIER silent_mutation Average:11.883; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg0819393368 G -> A LOC_Os08g31350-LOC_Os08g31360 intergenic_region ; MODIFIER silent_mutation Average:11.883; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg0819393368 G -> DEL N N silent_mutation Average:11.883; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819393368 NA 5.00E-09 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368 NA 7.24E-19 mr1422 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368 NA 2.56E-17 mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368 NA 1.71E-08 mr1852 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368 NA 2.33E-06 mr1159_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368 1.20E-06 1.20E-06 mr1284_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368 1.36E-06 1.36E-06 mr1286_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368 NA 5.74E-07 mr1299_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368 NA 1.08E-17 mr1352_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368 2.00E-08 2.00E-08 mr1412_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368 5.56E-09 5.56E-09 mr1417_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368 NA 2.07E-24 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368 2.36E-08 6.36E-09 mr1467_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368 7.02E-07 7.02E-07 mr1485_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368 7.55E-07 7.55E-07 mr1488_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368 2.53E-08 8.63E-09 mr1556_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368 NA 4.47E-06 mr1633_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368 9.43E-07 9.43E-07 mr1665_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368 NA 1.29E-06 mr1683_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368 3.81E-07 3.81E-07 mr1687_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368 NA 3.31E-07 mr1700_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368 7.02E-06 7.02E-06 mr1727_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368 3.84E-07 3.84E-07 mr1747_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368 2.58E-06 2.58E-06 mr1753_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368 NA 5.75E-07 mr1756_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368 5.94E-07 7.53E-09 mr1759_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368 2.59E-08 2.59E-08 mr1764_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368 NA 4.68E-06 mr1779_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368 1.36E-07 2.30E-08 mr1811_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368 1.84E-06 1.84E-06 mr1812_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368 3.47E-07 3.47E-07 mr1816_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368 3.61E-09 8.81E-11 mr1823_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368 1.98E-06 1.79E-07 mr1824_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368 1.53E-08 2.09E-09 mr1831_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368 5.68E-06 5.67E-06 mr1832_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368 9.33E-06 9.33E-06 mr1833_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368 NA 9.50E-07 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368 1.68E-07 1.68E-07 mr1840_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368 NA 1.11E-06 mr1854_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368 2.45E-07 1.11E-08 mr1856_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368 NA 4.65E-06 mr1976_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819393368 3.16E-06 9.17E-07 mr1985_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251