\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819378109:

Variant ID: vg0819378109 (JBrowse)Variation Type: INDEL
Chromosome: chr08Position: 19378109
Reference Allele: TAlternative Allele: A,TA,TTA
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.89, A: 0.11, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


GTTTTCCGCGCGCACGTTTTTCAAACTACTAAACGGTGTGATTTATGCAAAAACTTTCTATATAAAAGTTGTTTAAAAAAATCATATTAATCTATTTTTT[T/A,TA,TTA]
AAAAAATAATTAATACTTAATTAATCATGCAATAATACAAGCTTTGATTTGTGTGTCCCTCCTCCCGAACACAGTCTTAGTACGAAGTTCCCATATACCG

Reverse complement sequence

CGGTATATGGGAACTTCGTACTAAGACTGTGTTCGGGAGGAGGGACACACAAATCAAAGCTTGTATTATTGCATGATTAATTAAGTATTAATTATTTTTT[A/T,TA,TAA]
AAAAAATAGATTAATATGATTTTTTTAAACAACTTTTATATAGAAAGTTTTTGCATAAATCACACCGTTTAGTAGTTTGAAAAACGTGCGCGCGGAAAAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.40% 37.60% 1.42% 0.00% TA: 10.39%; TTA: 1.18%
All Indica  2759 26.70% 60.60% 1.74% 0.00% TA: 8.95%; TTA: 1.99%
All Japonica  1512 94.20% 4.40% 0.99% 0.00% TA: 0.26%; TTA: 0.07%
Aus  269 11.50% 2.60% 0.37% 0.00% TA: 85.50%
Indica I  595 8.90% 79.50% 1.85% 0.00% TA: 9.75%
Indica II  465 9.90% 84.70% 1.94% 0.00% TA: 3.44%
Indica III  913 39.50% 43.80% 1.64% 0.00% TA: 9.64%; TTA: 5.37%
Indica Intermediate  786 35.20% 51.50% 1.65% 0.00% TA: 10.81%; TTA: 0.76%
Temperate Japonica  767 99.20% 0.50% 0.13% 0.00% TA: 0.13%
Tropical Japonica  504 86.90% 10.50% 2.18% 0.00% TTA: 0.20%; TA: 0.20%
Japonica Intermediate  241 93.80% 4.10% 1.24% 0.00% TA: 0.83%
VI/Aromatic  96 92.70% 1.00% 0.00% 0.00% TA: 6.25%
Intermediate  90 57.80% 34.40% 3.33% 0.00% TA: 4.44%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819378109 T -> TA LOC_Os08g31340.1 upstream_gene_variant ; 4842.0bp to feature; MODIFIER silent_mutation Average:28.529; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg0819378109 T -> TA LOC_Os08g31320.1 downstream_gene_variant ; 4619.0bp to feature; MODIFIER silent_mutation Average:28.529; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg0819378109 T -> TA LOC_Os08g31320-LOC_Os08g31340 intergenic_region ; MODIFIER silent_mutation Average:28.529; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg0819378109 T -> A LOC_Os08g31340.1 upstream_gene_variant ; 4843.0bp to feature; MODIFIER silent_mutation Average:28.529; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg0819378109 T -> A LOC_Os08g31320.1 downstream_gene_variant ; 4618.0bp to feature; MODIFIER silent_mutation Average:28.529; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg0819378109 T -> A LOC_Os08g31320-LOC_Os08g31340 intergenic_region ; MODIFIER silent_mutation Average:28.529; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg0819378109 T -> TTA LOC_Os08g31340.1 upstream_gene_variant ; 4842.0bp to feature; MODIFIER silent_mutation Average:28.529; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg0819378109 T -> TTA LOC_Os08g31320.1 downstream_gene_variant ; 4619.0bp to feature; MODIFIER silent_mutation Average:28.529; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg0819378109 T -> TTA LOC_Os08g31320-LOC_Os08g31340 intergenic_region ; MODIFIER silent_mutation Average:28.529; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819378109 NA 1.11E-06 mr1212 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 1.45E-11 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 2.06E-41 mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 8.47E-06 mr1060_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 2.61E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 3.11E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 1.56E-07 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 4.96E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 7.50E-06 mr1207_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 4.90E-10 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 4.87E-21 mr1218_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 1.27E-07 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 1.47E-09 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 2.13E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 6.99E-07 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 1.34E-17 mr1260_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 4.18E-06 mr1283_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 7.64E-09 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 9.83E-06 mr1345_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 4.63E-06 2.58E-25 mr1352_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 2.17E-12 mr1352_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 4.04E-07 mr1358_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 6.34E-10 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 6.36E-06 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 4.97E-06 mr1421_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 1.87E-06 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 4.07E-06 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 1.68E-10 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 9.57E-06 mr1431_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 3.39E-15 mr1454_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 7.65E-06 mr1454_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 2.23E-06 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 3.18E-14 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 5.38E-06 mr1566_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 2.81E-06 mr1580_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 2.01E-07 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 7.09E-23 mr1627_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 5.57E-09 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 1.59E-07 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 3.05E-07 mr1756_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 5.96E-06 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 5.95E-06 mr1820_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 2.90E-07 mr1820_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 5.42E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 1.28E-06 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 1.86E-13 mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 3.39E-08 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 3.62E-26 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 1.44E-06 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 1.42E-06 mr1954_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819378109 NA 2.23E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251