\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819368604:

Variant ID: vg0819368604 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19368604
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATCGGTAGTTTTGTGATATATTGTGCAAAGTACATGTAGTTTTGTGATAAACGAAGACACTAAATCTTTAGTTTTGTGAAACGAGGTTTTAAATCTATA[T/G]
TTTTCTGATATATCGTGCAAAGTATATGTAGTTTTATAAAATTTACACTTTTTTACGAGAAACTTAGATGGCAGGAGATTTATCGGATATATTACACGCA

Reverse complement sequence

TGCGTGTAATATATCCGATAAATCTCCTGCCATCTAAGTTTCTCGTAAAAAAGTGTAAATTTTATAAAACTACATATACTTTGCACGATATATCAGAAAA[A/C]
TATAGATTTAAAACCTCGTTTCACAAAACTAAAGATTTAGTGTCTTCGTTTATCACAAAACTACATGTACTTTGCACAATATATCACAAAACTACCGATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.60% 8.40% 0.00% 0.00% NA
All Indica  2759 94.70% 5.30% 0.00% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 13.80% 86.20% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 97.60% 2.40% 0.00% 0.00% NA
Indica III  913 90.40% 9.60% 0.00% 0.00% NA
Indica Intermediate  786 93.90% 6.10% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819368604 T -> G LOC_Os08g31300.1 upstream_gene_variant ; 3658.0bp to feature; MODIFIER silent_mutation Average:22.554; most accessible tissue: Zhenshan97 root, score: 32.766 N N N N
vg0819368604 T -> G LOC_Os08g31320.1 upstream_gene_variant ; 3008.0bp to feature; MODIFIER silent_mutation Average:22.554; most accessible tissue: Zhenshan97 root, score: 32.766 N N N N
vg0819368604 T -> G LOC_Os08g31310.1 downstream_gene_variant ; 743.0bp to feature; MODIFIER silent_mutation Average:22.554; most accessible tissue: Zhenshan97 root, score: 32.766 N N N N
vg0819368604 T -> G LOC_Os08g31300-LOC_Os08g31310 intergenic_region ; MODIFIER silent_mutation Average:22.554; most accessible tissue: Zhenshan97 root, score: 32.766 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819368604 NA 1.47E-06 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819368604 NA 4.62E-17 mr1119 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819368604 NA 7.96E-21 mr1120 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819368604 NA 5.53E-06 mr1184 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819368604 NA 9.72E-06 mr1417 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819368604 5.64E-06 3.98E-52 mr1549 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819368604 NA 1.62E-52 mr1550 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819368604 NA 4.89E-50 mr1757 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819368604 NA 3.70E-08 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819368604 NA 9.52E-07 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819368604 NA 2.11E-09 mr1388_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819368604 NA 5.23E-40 mr1549_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819368604 NA 1.63E-51 mr1550_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819368604 NA 9.15E-33 mr1757_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819368604 8.67E-07 NA mr1835_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251