\
| Variant ID: vg0819368604 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 19368604 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AATCGGTAGTTTTGTGATATATTGTGCAAAGTACATGTAGTTTTGTGATAAACGAAGACACTAAATCTTTAGTTTTGTGAAACGAGGTTTTAAATCTATA[T/G]
TTTTCTGATATATCGTGCAAAGTATATGTAGTTTTATAAAATTTACACTTTTTTACGAGAAACTTAGATGGCAGGAGATTTATCGGATATATTACACGCA
TGCGTGTAATATATCCGATAAATCTCCTGCCATCTAAGTTTCTCGTAAAAAAGTGTAAATTTTATAAAACTACATATACTTTGCACGATATATCAGAAAA[A/C]
TATAGATTTAAAACCTCGTTTCACAAAACTAAAGATTTAGTGTCTTCGTTTATCACAAAACTACATGTACTTTGCACAATATATCACAAAACTACCGATT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.60% | 8.40% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 94.70% | 5.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 13.80% | 86.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 90.40% | 9.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 93.90% | 6.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0819368604 | T -> G | LOC_Os08g31300.1 | upstream_gene_variant ; 3658.0bp to feature; MODIFIER | silent_mutation | Average:22.554; most accessible tissue: Zhenshan97 root, score: 32.766 | N | N | N | N |
| vg0819368604 | T -> G | LOC_Os08g31320.1 | upstream_gene_variant ; 3008.0bp to feature; MODIFIER | silent_mutation | Average:22.554; most accessible tissue: Zhenshan97 root, score: 32.766 | N | N | N | N |
| vg0819368604 | T -> G | LOC_Os08g31310.1 | downstream_gene_variant ; 743.0bp to feature; MODIFIER | silent_mutation | Average:22.554; most accessible tissue: Zhenshan97 root, score: 32.766 | N | N | N | N |
| vg0819368604 | T -> G | LOC_Os08g31300-LOC_Os08g31310 | intergenic_region ; MODIFIER | silent_mutation | Average:22.554; most accessible tissue: Zhenshan97 root, score: 32.766 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0819368604 | NA | 1.47E-06 | mr1073 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819368604 | NA | 4.62E-17 | mr1119 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819368604 | NA | 7.96E-21 | mr1120 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819368604 | NA | 5.53E-06 | mr1184 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819368604 | NA | 9.72E-06 | mr1417 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819368604 | 5.64E-06 | 3.98E-52 | mr1549 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819368604 | NA | 1.62E-52 | mr1550 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819368604 | NA | 4.89E-50 | mr1757 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819368604 | NA | 3.70E-08 | mr1762 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819368604 | NA | 9.52E-07 | mr1774 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819368604 | NA | 2.11E-09 | mr1388_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819368604 | NA | 5.23E-40 | mr1549_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819368604 | NA | 1.63E-51 | mr1550_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819368604 | NA | 9.15E-33 | mr1757_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819368604 | 8.67E-07 | NA | mr1835_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |