Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819367990:

Variant ID: vg0819367990 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19367990
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.04, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


CACGCCATGTAGGAGCACTCTGAAGGGTCTAAGAAGGTACAAGCTGAGTTTTTTTAATATAAAATTTAAATGGTAGAAGTTAGGTTTTCTTGGACAGAGG[A/G]
ACTATTTGGCATGAACATGAAAATTCACTTAAATAATTAATTTAGTGTAGATATCTCAAACTGTATGCTTTAGCTCGCTCCCCTCTTCCCATCCTCTACA

Reverse complement sequence

TGTAGAGGATGGGAAGAGGGGAGCGAGCTAAAGCATACAGTTTGAGATATCTACACTAAATTAATTATTTAAGTGAATTTTCATGTTCATGCCAAATAGT[T/C]
CCTCTGTCCAAGAAAACCTAACTTCTACCATTTAAATTTTATATTAAAAAAACTCAGCTTGTACCTTCTTAGACCCTTCAGAGTGCTCCTACATGGCGTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.20% 30.60% 0.19% 0.02% NA
All Indica  2759 98.10% 1.70% 0.18% 0.00% NA
All Japonica  1512 15.90% 83.90% 0.13% 0.07% NA
Aus  269 96.30% 3.70% 0.00% 0.00% NA
Indica I  595 98.50% 1.30% 0.17% 0.00% NA
Indica II  465 99.40% 0.20% 0.43% 0.00% NA
Indica III  913 96.80% 3.10% 0.11% 0.00% NA
Indica Intermediate  786 98.60% 1.30% 0.13% 0.00% NA
Temperate Japonica  767 0.80% 99.10% 0.13% 0.00% NA
Tropical Japonica  504 41.30% 58.50% 0.20% 0.00% NA
Japonica Intermediate  241 11.20% 88.40% 0.00% 0.41% NA
VI/Aromatic  96 10.40% 89.60% 0.00% 0.00% NA
Intermediate  90 58.90% 38.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819367990 A -> G LOC_Os08g31300.1 upstream_gene_variant ; 3044.0bp to feature; MODIFIER silent_mutation Average:45.593; most accessible tissue: Callus, score: 76.578 N N N N
vg0819367990 A -> G LOC_Os08g31320.1 upstream_gene_variant ; 3622.0bp to feature; MODIFIER silent_mutation Average:45.593; most accessible tissue: Callus, score: 76.578 N N N N
vg0819367990 A -> G LOC_Os08g31310.1 downstream_gene_variant ; 1357.0bp to feature; MODIFIER silent_mutation Average:45.593; most accessible tissue: Callus, score: 76.578 N N N N
vg0819367990 A -> G LOC_Os08g31300-LOC_Os08g31310 intergenic_region ; MODIFIER silent_mutation Average:45.593; most accessible tissue: Callus, score: 76.578 N N N N
vg0819367990 A -> DEL N N silent_mutation Average:45.593; most accessible tissue: Callus, score: 76.578 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819367990 NA 1.84E-10 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819367990 9.06E-06 NA mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819367990 NA 1.10E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819367990 NA 6.58E-11 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819367990 NA 8.24E-10 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819367990 NA 5.64E-25 mr1217 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819367990 NA 8.51E-08 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819367990 NA 2.44E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819367990 NA 2.59E-10 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819367990 NA 2.65E-24 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819367990 NA 5.36E-16 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819367990 NA 4.09E-13 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819367990 NA 1.40E-27 mr1414 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819367990 NA 5.43E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819367990 NA 5.36E-16 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819367990 NA 9.68E-09 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819367990 9.50E-08 NA mr1560 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819367990 NA 1.83E-06 mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819367990 NA 5.15E-09 mr1575 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819367990 NA 1.43E-26 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819367990 NA 1.10E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819367990 NA 8.40E-21 mr1698 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819367990 NA 3.50E-10 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819367990 NA 5.86E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819367990 NA 2.53E-23 mr1845 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819367990 NA 6.74E-11 mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819367990 NA 8.85E-07 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819367990 NA 3.66E-29 mr1922 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819367990 NA 3.63E-12 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819367990 NA 2.35E-07 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819367990 NA 1.69E-07 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819367990 NA 1.80E-13 mr1827_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819367990 NA 1.27E-15 mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819367990 NA 3.42E-15 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251