Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819366594:

Variant ID: vg0819366594 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 19366594
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

AGGAGGCAACACTTTTTCTATTATAATGTATAGCAATACTGATGTTCCAATTTATTCCTCGGATCCTAATAACTGTTGTATCACTAGAAAAAAATGCCTT[T/A]
ACCTGTTCTAATGCATGGGCACTTTTTCTGGTTAATGTAAAAAGTTGTATTGAATTGTGGGTAGGTAAGATGTATTTAAAGAATAAAAATTCTTGATCTG

Reverse complement sequence

CAGATCAAGAATTTTTATTCTTTAAATACATCTTACCTACCCACAATTCAATACAACTTTTTACATTAACCAGAAAAAGTGCCCATGCATTAGAACAGGT[A/T]
AAGGCATTTTTTTCTAGTGATACAACAGTTATTAGGATCCGAGGAATAAATTGGAACATCAGTATTGCTATACATTATAATAGAAAAAGTGTTGCCTCCT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.10%	2.80%	0.15%	0.00%	NA
All Indica	2759	98.90%	1.10%	0.00%	0.00%	NA
All Japonica	1512	95.40%	4.20%	0.46%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	97.20%	2.80%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.40%	0.00%	0.00%	NA
Temperate Japonica	767	93.50%	5.70%	0.78%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	91.70%	7.90%	0.41%	0.00%	NA
VI/Aromatic	96	58.30%	41.70%	0.00%	0.00%	NA
Intermediate	90	100.00%	0.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0819366594	T -> A	LOC_Os08g31300.1	upstream_gene_variant ; 1648.0bp to feature; MODIFIER	silent_mutation	Average:51.685; most accessible tissue: Zhenshan97 young leaf, score: 78.644	N	N	N	N
vg0819366594	T -> A	LOC_Os08g31310.1	downstream_gene_variant ; 2753.0bp to feature; MODIFIER	silent_mutation	Average:51.685; most accessible tissue: Zhenshan97 young leaf, score: 78.644	N	N	N	N
vg0819366594	T -> A	LOC_Os08g31300-LOC_Os08g31310	intergenic_region ; MODIFIER	silent_mutation	Average:51.685; most accessible tissue: Zhenshan97 young leaf, score: 78.644	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0819366594	1.58E-06	1.58E-06	mr1973	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251