Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0819332152:

Variant ID: vg0819332152 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19332152
Reference Allele: GAlternative Allele: C,T
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACCGTGCATTATATTAGTGCAGTTAATTTATTCCTGACGCAACATATATATAACTTCTCCGTATATACTTCCTCCGTATTTTAATGTATGACGCCGTTGA[G/C,T]
TTTTTAACCAATGTTTAACCATTCGTTTTATTCAATTTTTTGTGCAAATATAAAAATATTTATGTTATGTTTAAAGAACATTCGATGATAAATGAAGTCA

Reverse complement sequence

TGACTTCATTTATCATCGAATGTTCTTTAAACATAACATAAATATTTTTATATTTGCACAAAAAATTGAATAAAACGAATGGTTAAACATTGGTTAAAAA[C/G,A]
TCAACGGCGTCATACATTAAAATACGGAGGAAGTATATACGGAGAAGTTATATATATGTTGCGTCAGGAATAAATTAACTGCACTAATATAATGCACGGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.30% 26.60% 0.08% 0.00% T: 0.02%
All Indica  2759 96.70% 3.20% 0.07% 0.00% T: 0.04%
All Japonica  1512 28.00% 71.90% 0.07% 0.00% NA
Aus  269 96.70% 3.30% 0.00% 0.00% NA
Indica I  595 98.80% 1.00% 0.17% 0.00% NA
Indica II  465 99.10% 0.60% 0.22% 0.00% NA
Indica III  913 94.40% 5.50% 0.00% 0.00% T: 0.11%
Indica Intermediate  786 96.20% 3.80% 0.00% 0.00% NA
Temperate Japonica  767 24.90% 75.00% 0.13% 0.00% NA
Tropical Japonica  504 36.50% 63.50% 0.00% 0.00% NA
Japonica Intermediate  241 20.30% 79.70% 0.00% 0.00% NA
VI/Aromatic  96 60.40% 39.60% 0.00% 0.00% NA
Intermediate  90 62.20% 36.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819332152 G -> C LOC_Os08g31260.1 downstream_gene_variant ; 2840.0bp to feature; MODIFIER silent_mutation Average:72.54; most accessible tissue: Zhenshan97 root, score: 97.316 N N N N
vg0819332152 G -> C LOC_Os08g31250-LOC_Os08g31260 intergenic_region ; MODIFIER silent_mutation Average:72.54; most accessible tissue: Zhenshan97 root, score: 97.316 N N N N
vg0819332152 G -> T LOC_Os08g31260.1 downstream_gene_variant ; 2840.0bp to feature; MODIFIER silent_mutation Average:72.54; most accessible tissue: Zhenshan97 root, score: 97.316 N N N N
vg0819332152 G -> T LOC_Os08g31250-LOC_Os08g31260 intergenic_region ; MODIFIER silent_mutation Average:72.54; most accessible tissue: Zhenshan97 root, score: 97.316 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0819332152 G C 0.13 0.03 0.02 0.01 -0.01 -0.03
vg0819332152 G T -0.02 0.0 -0.01 -0.02 -0.03 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819332152 NA 4.73E-10 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819332152 NA 1.42E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819332152 NA 4.70E-08 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819332152 NA 4.91E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819332152 NA 5.79E-06 mr1407 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819332152 NA 1.75E-07 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819332152 NA 1.75E-08 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819332152 NA 2.66E-29 mr1922 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819332152 NA 1.19E-15 mr1940 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251