\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819321720:

Variant ID: vg0819321720 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19321720
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTGAGAGATACATTGGGAATGTATCCTATAGACGCAAGTTTTCATACCGTATACATCAACTAACAAATATCACTAAAAATTTTAGAAAACTTTGTACAT[G/A]
TACTTTCAATAGTATTATATCTACATATAAAGTCACACCTTTAAATTTATTTTACATAAAGAGCAATAAAAAAGATAAAATTAAGATAGACTTGTAGTCT

Reverse complement sequence

AGACTACAAGTCTATCTTAATTTTATCTTTTTTATTGCTCTTTATGTAAAATAAATTTAAAGGTGTGACTTTATATGTAGATATAATACTATTGAAAGTA[C/T]
ATGTACAAAGTTTTCTAAAATTTTTAGTGATATTTGTTAGTTGATGTATACGGTATGAAAACTTGCGTCTATAGGATACATTCCCAATGTATCTCTCAGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.90% 27.80% 0.06% 3.22% NA
All Indica  2759 90.80% 3.70% 0.04% 5.47% NA
All Japonica  1512 28.00% 71.90% 0.07% 0.00% NA
Aus  269 85.50% 14.50% 0.00% 0.00% NA
Indica I  595 78.50% 1.00% 0.17% 20.34% NA
Indica II  465 96.30% 1.10% 0.00% 2.58% NA
Indica III  913 91.70% 8.30% 0.00% 0.00% NA
Indica Intermediate  786 95.70% 2.00% 0.00% 2.29% NA
Temperate Japonica  767 24.90% 75.00% 0.13% 0.00% NA
Tropical Japonica  504 36.50% 63.50% 0.00% 0.00% NA
Japonica Intermediate  241 20.30% 79.70% 0.00% 0.00% NA
VI/Aromatic  96 53.10% 46.90% 0.00% 0.00% NA
Intermediate  90 51.10% 46.70% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819321720 G -> A LOC_Os08g31250.1 upstream_gene_variant ; 3416.0bp to feature; MODIFIER silent_mutation Average:37.255; most accessible tissue: Callus, score: 79.813 N N N N
vg0819321720 G -> A LOC_Os08g31240.1 downstream_gene_variant ; 3489.0bp to feature; MODIFIER silent_mutation Average:37.255; most accessible tissue: Callus, score: 79.813 N N N N
vg0819321720 G -> A LOC_Os08g31240-LOC_Os08g31250 intergenic_region ; MODIFIER silent_mutation Average:37.255; most accessible tissue: Callus, score: 79.813 N N N N
vg0819321720 G -> DEL N N silent_mutation Average:37.255; most accessible tissue: Callus, score: 79.813 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819321720 NA 1.70E-06 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819321720 1.97E-06 3.87E-06 mr1732 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251