\
| Variant ID: vg0819321674 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 19321674 |
| Reference Allele: C | Alternative Allele: T,A |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TAACTGGATTCGGAAACATTTGACAGTGAGACGGGATAATATATGTACTGAGAGATACATTGGGAATGTATCCTATAGACGCAAGTTTTCATACCGTATA[C/T,A]
ATCAACTAACAAATATCACTAAAAATTTTAGAAAACTTTGTACATGTACTTTCAATAGTATTATATCTACATATAAAGTCACACCTTTAAATTTATTTTA
TAAAATAAATTTAAAGGTGTGACTTTATATGTAGATATAATACTATTGAAAGTACATGTACAAAGTTTTCTAAAATTTTTAGTGATATTTGTTAGTTGAT[G/A,T]
TATACGGTATGAAAACTTGCGTCTATAGGATACATTCCCAATGTATCTCTCAGTACATATATTATCCCGTCTCACTGTCAAATGTTTCCGAATCCAGTTA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.50% | 29.20% | 0.04% | 3.24% | A: 0.95% |
| All Indica | 2759 | 85.60% | 7.20% | 0.00% | 5.51% | A: 1.63% |
| All Japonica | 1512 | 28.00% | 71.90% | 0.07% | 0.00% | NA |
| Aus | 269 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 68.40% | 11.30% | 0.00% | 20.34% | NA |
| Indica II | 465 | 96.30% | 0.90% | 0.00% | 2.80% | NA |
| Indica III | 913 | 87.00% | 8.40% | 0.00% | 0.00% | A: 4.60% |
| Indica Intermediate | 786 | 90.80% | 6.50% | 0.00% | 2.29% | A: 0.38% |
| Temperate Japonica | 767 | 24.90% | 75.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 36.50% | 63.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 20.30% | 79.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 53.10% | 46.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 52.20% | 45.60% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0819321674 | C -> T | LOC_Os08g31250.1 | upstream_gene_variant ; 3462.0bp to feature; MODIFIER | silent_mutation | Average:33.993; most accessible tissue: Callus, score: 57.945 | N | N | N | N |
| vg0819321674 | C -> T | LOC_Os08g31240.1 | downstream_gene_variant ; 3443.0bp to feature; MODIFIER | silent_mutation | Average:33.993; most accessible tissue: Callus, score: 57.945 | N | N | N | N |
| vg0819321674 | C -> T | LOC_Os08g31240-LOC_Os08g31250 | intergenic_region ; MODIFIER | silent_mutation | Average:33.993; most accessible tissue: Callus, score: 57.945 | N | N | N | N |
| vg0819321674 | C -> A | LOC_Os08g31250.1 | upstream_gene_variant ; 3462.0bp to feature; MODIFIER | silent_mutation | Average:33.993; most accessible tissue: Callus, score: 57.945 | N | N | N | N |
| vg0819321674 | C -> A | LOC_Os08g31240.1 | downstream_gene_variant ; 3443.0bp to feature; MODIFIER | silent_mutation | Average:33.993; most accessible tissue: Callus, score: 57.945 | N | N | N | N |
| vg0819321674 | C -> A | LOC_Os08g31240-LOC_Os08g31250 | intergenic_region ; MODIFIER | silent_mutation | Average:33.993; most accessible tissue: Callus, score: 57.945 | N | N | N | N |
| vg0819321674 | C -> DEL | N | N | silent_mutation | Average:33.993; most accessible tissue: Callus, score: 57.945 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0819321674 | NA | 3.61E-07 | mr1227 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819321674 | 3.70E-06 | NA | mr1579 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819321674 | NA | 1.58E-06 | mr1646 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |