\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819321674:

Variant ID: vg0819321674 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19321674
Reference Allele: CAlternative Allele: T,A
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAACTGGATTCGGAAACATTTGACAGTGAGACGGGATAATATATGTACTGAGAGATACATTGGGAATGTATCCTATAGACGCAAGTTTTCATACCGTATA[C/T,A]
ATCAACTAACAAATATCACTAAAAATTTTAGAAAACTTTGTACATGTACTTTCAATAGTATTATATCTACATATAAAGTCACACCTTTAAATTTATTTTA

Reverse complement sequence

TAAAATAAATTTAAAGGTGTGACTTTATATGTAGATATAATACTATTGAAAGTACATGTACAAAGTTTTCTAAAATTTTTAGTGATATTTGTTAGTTGAT[G/A,T]
TATACGGTATGAAAACTTGCGTCTATAGGATACATTCCCAATGTATCTCTCAGTACATATATTATCCCGTCTCACTGTCAAATGTTTCCGAATCCAGTTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.50% 29.20% 0.04% 3.24% A: 0.95%
All Indica  2759 85.60% 7.20% 0.00% 5.51% A: 1.63%
All Japonica  1512 28.00% 71.90% 0.07% 0.00% NA
Aus  269 96.30% 3.70% 0.00% 0.00% NA
Indica I  595 68.40% 11.30% 0.00% 20.34% NA
Indica II  465 96.30% 0.90% 0.00% 2.80% NA
Indica III  913 87.00% 8.40% 0.00% 0.00% A: 4.60%
Indica Intermediate  786 90.80% 6.50% 0.00% 2.29% A: 0.38%
Temperate Japonica  767 24.90% 75.00% 0.13% 0.00% NA
Tropical Japonica  504 36.50% 63.50% 0.00% 0.00% NA
Japonica Intermediate  241 20.30% 79.70% 0.00% 0.00% NA
VI/Aromatic  96 53.10% 46.90% 0.00% 0.00% NA
Intermediate  90 52.20% 45.60% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819321674 C -> T LOC_Os08g31250.1 upstream_gene_variant ; 3462.0bp to feature; MODIFIER silent_mutation Average:33.993; most accessible tissue: Callus, score: 57.945 N N N N
vg0819321674 C -> T LOC_Os08g31240.1 downstream_gene_variant ; 3443.0bp to feature; MODIFIER silent_mutation Average:33.993; most accessible tissue: Callus, score: 57.945 N N N N
vg0819321674 C -> T LOC_Os08g31240-LOC_Os08g31250 intergenic_region ; MODIFIER silent_mutation Average:33.993; most accessible tissue: Callus, score: 57.945 N N N N
vg0819321674 C -> A LOC_Os08g31250.1 upstream_gene_variant ; 3462.0bp to feature; MODIFIER silent_mutation Average:33.993; most accessible tissue: Callus, score: 57.945 N N N N
vg0819321674 C -> A LOC_Os08g31240.1 downstream_gene_variant ; 3443.0bp to feature; MODIFIER silent_mutation Average:33.993; most accessible tissue: Callus, score: 57.945 N N N N
vg0819321674 C -> A LOC_Os08g31240-LOC_Os08g31250 intergenic_region ; MODIFIER silent_mutation Average:33.993; most accessible tissue: Callus, score: 57.945 N N N N
vg0819321674 C -> DEL N N silent_mutation Average:33.993; most accessible tissue: Callus, score: 57.945 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819321674 NA 3.61E-07 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819321674 3.70E-06 NA mr1579 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819321674 NA 1.58E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251