Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819320324:

Variant ID: vg0819320324 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 19320324
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:

GACACGAATGAAAAAACTAATTTTATAACTCGCCTGGAAACCGCGAGACGAATCTTTTGAGCCTAATTAATCCGTCATTAGCATATGTTGGTTACTGTAG[C/T]
ACTTATGGCTAATCATAGACTAATTAGGCTCAAAAGATTCGGCTCACAATTTCCTCCTAACTGTGCAATTAGTTTTTGTTTTTATCTATATTTAATTCTT

Reverse complement sequence

AAGAATTAAATATAGATAAAAACAAAAACTAATTGCACAGTTAGGAGGAAATTGTGAGCCGAATCTTTTGAGCCTAATTAGTCTATGATTAGCCATAAGT[G/A]
CTACAGTAACCAACATATGCTAATGACGGATTAATTAGGCTCAAAAGATTCGTCTCGCGGTTTCCAGGCGAGTTATAAAATTAGTTTTTTCATTCGTGTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.20%	22.90%	0.06%	2.84%	NA
All Indica	2759	63.20%	31.90%	0.07%	4.82%	NA
All Japonica	1512	87.60%	12.30%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	74.10%	7.90%	0.17%	17.82%	NA
Indica II	465	88.00%	9.70%	0.00%	2.37%	NA
Indica III	913	47.90%	52.10%	0.00%	0.00%	NA
Indica Intermediate	786	58.10%	39.70%	0.13%	2.04%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	66.30%	33.50%	0.20%	0.00%	NA
Japonica Intermediate	241	92.90%	7.10%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	85.60%	13.30%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0819320324	C -> T	LOC_Os08g31250.1	upstream_gene_variant ; 4812.0bp to feature; MODIFIER	silent_mutation	Average:57.132; most accessible tissue: Callus, score: 86.056	N	N	N	N
vg0819320324	C -> T	LOC_Os08g31240.1	downstream_gene_variant ; 2093.0bp to feature; MODIFIER	silent_mutation	Average:57.132; most accessible tissue: Callus, score: 86.056	N	N	N	N
vg0819320324	C -> T	LOC_Os08g31240-LOC_Os08g31250	intergenic_region ; MODIFIER	silent_mutation	Average:57.132; most accessible tissue: Callus, score: 86.056	N	N	N	N
vg0819320324	C -> DEL	N	N	silent_mutation	Average:57.132; most accessible tissue: Callus, score: 86.056	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0819320324	NA	6.81E-11	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0819320324	NA	5.21E-10	Heading_date	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0819320324	NA	4.68E-06	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819320324	NA	5.27E-06	mr1227	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819320324	2.62E-08	2.62E-08	mr1266	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819320324	NA	1.06E-06	mr1350	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819320324	8.52E-06	8.52E-06	mr1537	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819320324	NA	1.58E-06	mr1560	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819320324	NA	9.32E-06	mr1606	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819320324	NA	9.23E-07	mr1695	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819320324	NA	5.65E-07	mr1866	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819320324	NA	9.37E-06	mr1870	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819320324	4.57E-06	1.13E-07	mr1890	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819320324	8.82E-06	8.82E-06	mr1891	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251