Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0819320324:

Variant ID: vg0819320324 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19320324
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


GACACGAATGAAAAAACTAATTTTATAACTCGCCTGGAAACCGCGAGACGAATCTTTTGAGCCTAATTAATCCGTCATTAGCATATGTTGGTTACTGTAG[C/T]
ACTTATGGCTAATCATAGACTAATTAGGCTCAAAAGATTCGGCTCACAATTTCCTCCTAACTGTGCAATTAGTTTTTGTTTTTATCTATATTTAATTCTT

Reverse complement sequence

AAGAATTAAATATAGATAAAAACAAAAACTAATTGCACAGTTAGGAGGAAATTGTGAGCCGAATCTTTTGAGCCTAATTAGTCTATGATTAGCCATAAGT[G/A]
CTACAGTAACCAACATATGCTAATGACGGATTAATTAGGCTCAAAAGATTCGTCTCGCGGTTTCCAGGCGAGTTATAAAATTAGTTTTTTCATTCGTGTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.20% 22.90% 0.06% 2.84% NA
All Indica  2759 63.20% 31.90% 0.07% 4.82% NA
All Japonica  1512 87.60% 12.30% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 74.10% 7.90% 0.17% 17.82% NA
Indica II  465 88.00% 9.70% 0.00% 2.37% NA
Indica III  913 47.90% 52.10% 0.00% 0.00% NA
Indica Intermediate  786 58.10% 39.70% 0.13% 2.04% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 66.30% 33.50% 0.20% 0.00% NA
Japonica Intermediate  241 92.90% 7.10% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 85.60% 13.30% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819320324 C -> T LOC_Os08g31250.1 upstream_gene_variant ; 4812.0bp to feature; MODIFIER silent_mutation Average:57.132; most accessible tissue: Callus, score: 86.056 N N N N
vg0819320324 C -> T LOC_Os08g31240.1 downstream_gene_variant ; 2093.0bp to feature; MODIFIER silent_mutation Average:57.132; most accessible tissue: Callus, score: 86.056 N N N N
vg0819320324 C -> T LOC_Os08g31240-LOC_Os08g31250 intergenic_region ; MODIFIER silent_mutation Average:57.132; most accessible tissue: Callus, score: 86.056 N N N N
vg0819320324 C -> DEL N N silent_mutation Average:57.132; most accessible tissue: Callus, score: 86.056 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819320324 NA 6.81E-11 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0819320324 NA 5.21E-10 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0819320324 NA 4.68E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819320324 NA 5.27E-06 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819320324 2.62E-08 2.62E-08 mr1266 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819320324 NA 1.06E-06 mr1350 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819320324 8.52E-06 8.52E-06 mr1537 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819320324 NA 1.58E-06 mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819320324 NA 9.32E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819320324 NA 9.23E-07 mr1695 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819320324 NA 5.65E-07 mr1866 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819320324 NA 9.37E-06 mr1870 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819320324 4.57E-06 1.13E-07 mr1890 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819320324 8.82E-06 8.82E-06 mr1891 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251