\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819275819:

Variant ID: vg0819275819 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19275819
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATCATTCGCCTTATTCAAAAAATTTAAGTTCATATCATTTGATTTATTGTTAAATATACTTTCATTTACACATATAGTTTTACATATTTCAATATTTCA[T/C]
AAATTTTTTTAATAAGACGAACGGTCAAACATGTGCTAAAAAGTCAATGGTGTCAAAAATTTTAAAATGGTGGGAGTAATAAACTACATATAAGACCCTC

Reverse complement sequence

GAGGGTCTTATATGTAGTTTATTACTCCCACCATTTTAAAATTTTTGACACCATTGACTTTTTAGCACATGTTTGACCGTTCGTCTTATTAAAAAAATTT[A/G]
TGAAATATTGAAATATGTAAAACTATATGTGTAAATGAAAGTATATTTAACAATAAATCAAATGATATGAACTTAAATTTTTTGAATAAGGCGAATGATC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.30% 16.20% 13.37% 5.08% NA
All Indica  2759 72.80% 3.60% 16.49% 7.14% NA
All Japonica  1512 47.60% 38.90% 10.91% 2.58% NA
Aus  269 96.30% 3.30% 0.37% 0.00% NA
Indica I  595 81.30% 2.20% 14.12% 2.35% NA
Indica II  465 83.40% 1.90% 9.03% 5.59% NA
Indica III  913 66.40% 5.10% 17.63% 10.84% NA
Indica Intermediate  786 67.60% 3.70% 21.37% 7.38% NA
Temperate Japonica  767 71.30% 20.20% 8.47% 0.00% NA
Tropical Japonica  504 21.00% 56.50% 15.08% 7.34% NA
Japonica Intermediate  241 27.80% 61.40% 9.96% 0.83% NA
VI/Aromatic  96 52.10% 44.80% 3.12% 0.00% NA
Intermediate  90 54.40% 32.20% 8.89% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819275819 T -> C LOC_Os08g31180.1 upstream_gene_variant ; 1501.0bp to feature; MODIFIER silent_mutation Average:53.725; most accessible tissue: Callus, score: 85.86 N N N N
vg0819275819 T -> C LOC_Os08g31190.1 downstream_gene_variant ; 2865.0bp to feature; MODIFIER silent_mutation Average:53.725; most accessible tissue: Callus, score: 85.86 N N N N
vg0819275819 T -> C LOC_Os08g31170-LOC_Os08g31180 intergenic_region ; MODIFIER silent_mutation Average:53.725; most accessible tissue: Callus, score: 85.86 N N N N
vg0819275819 T -> DEL N N silent_mutation Average:53.725; most accessible tissue: Callus, score: 85.86 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819275819 NA 1.09E-06 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819275819 NA 1.59E-09 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819275819 NA 3.11E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819275819 NA 3.33E-08 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819275819 NA 2.48E-06 mr1320 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819275819 NA 3.10E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819275819 NA 1.06E-11 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819275819 NA 9.37E-07 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819275819 NA 3.38E-06 mr1602 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819275819 NA 8.50E-06 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819275819 NA 1.62E-09 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819275819 2.21E-06 NA mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819275819 NA 1.25E-12 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819275819 NA 7.37E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819275819 7.40E-06 NA mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819275819 NA 2.62E-11 mr1182_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819275819 NA 3.65E-08 mr1282_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819275819 NA 5.32E-08 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819275819 NA 4.99E-06 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819275819 NA 9.30E-10 mr1388_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819275819 NA 3.63E-07 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819275819 NA 3.17E-08 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251