| Variant ID: vg0819275819 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 19275819 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GATCATTCGCCTTATTCAAAAAATTTAAGTTCATATCATTTGATTTATTGTTAAATATACTTTCATTTACACATATAGTTTTACATATTTCAATATTTCA[T/C]
AAATTTTTTTAATAAGACGAACGGTCAAACATGTGCTAAAAAGTCAATGGTGTCAAAAATTTTAAAATGGTGGGAGTAATAAACTACATATAAGACCCTC
GAGGGTCTTATATGTAGTTTATTACTCCCACCATTTTAAAATTTTTGACACCATTGACTTTTTAGCACATGTTTGACCGTTCGTCTTATTAAAAAAATTT[A/G]
TGAAATATTGAAATATGTAAAACTATATGTGTAAATGAAAGTATATTTAACAATAAATCAAATGATATGAACTTAAATTTTTTGAATAAGGCGAATGATC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.30% | 16.20% | 13.37% | 5.08% | NA |
| All Indica | 2759 | 72.80% | 3.60% | 16.49% | 7.14% | NA |
| All Japonica | 1512 | 47.60% | 38.90% | 10.91% | 2.58% | NA |
| Aus | 269 | 96.30% | 3.30% | 0.37% | 0.00% | NA |
| Indica I | 595 | 81.30% | 2.20% | 14.12% | 2.35% | NA |
| Indica II | 465 | 83.40% | 1.90% | 9.03% | 5.59% | NA |
| Indica III | 913 | 66.40% | 5.10% | 17.63% | 10.84% | NA |
| Indica Intermediate | 786 | 67.60% | 3.70% | 21.37% | 7.38% | NA |
| Temperate Japonica | 767 | 71.30% | 20.20% | 8.47% | 0.00% | NA |
| Tropical Japonica | 504 | 21.00% | 56.50% | 15.08% | 7.34% | NA |
| Japonica Intermediate | 241 | 27.80% | 61.40% | 9.96% | 0.83% | NA |
| VI/Aromatic | 96 | 52.10% | 44.80% | 3.12% | 0.00% | NA |
| Intermediate | 90 | 54.40% | 32.20% | 8.89% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0819275819 | T -> C | LOC_Os08g31180.1 | upstream_gene_variant ; 1501.0bp to feature; MODIFIER | silent_mutation | Average:53.725; most accessible tissue: Callus, score: 85.86 | N | N | N | N |
| vg0819275819 | T -> C | LOC_Os08g31190.1 | downstream_gene_variant ; 2865.0bp to feature; MODIFIER | silent_mutation | Average:53.725; most accessible tissue: Callus, score: 85.86 | N | N | N | N |
| vg0819275819 | T -> C | LOC_Os08g31170-LOC_Os08g31180 | intergenic_region ; MODIFIER | silent_mutation | Average:53.725; most accessible tissue: Callus, score: 85.86 | N | N | N | N |
| vg0819275819 | T -> DEL | N | N | silent_mutation | Average:53.725; most accessible tissue: Callus, score: 85.86 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0819275819 | NA | 1.09E-06 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819275819 | NA | 1.59E-09 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819275819 | NA | 3.11E-06 | mr1183 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819275819 | NA | 3.33E-08 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819275819 | NA | 2.48E-06 | mr1320 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819275819 | NA | 3.10E-06 | mr1503 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819275819 | NA | 1.06E-11 | mr1540 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819275819 | NA | 9.37E-07 | mr1596 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819275819 | NA | 3.38E-06 | mr1602 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819275819 | NA | 8.50E-06 | mr1621 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/