\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819260710:

Variant ID: vg0819260710 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19260710
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGGCGGATTTCACCGGAATCAACTCCGGTCGCCGCCGCTATGGGAGCAATTGGGGGAAAAGCTATTCCGGCCATCCCCGACCCCCGCCCCTTCGTGCGCA[T/C]
GTCCTGGTGAACCCATGGCCACCCTAGAGCTCCAACTTCGCATCCCCCATGCCTTCGCCATCGTCACCGGGCCGGCGTCCATGGTGTCCGCACATAGTCT

Reverse complement sequence

AGACTATGTGCGGACACCATGGACGCCGGCCCGGTGACGATGGCGAAGGCATGGGGGATGCGAAGTTGGAGCTCTAGGGTGGCCATGGGTTCACCAGGAC[A/G]
TGCGCACGAAGGGGCGGGGGTCGGGGATGGCCGGAATAGCTTTTCCCCCAATTGCTCCCATAGCGGCGGCGACCGGAGTTGATTCCGGTGAAATCCGCCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.50% 9.50% 1.50% 0.44% NA
All Indica  2759 99.60% 0.20% 0.14% 0.04% NA
All Japonica  1512 66.80% 29.00% 4.23% 0.00% NA
Aus  269 92.20% 0.00% 0.37% 7.43% NA
Indica I  595 99.70% 0.00% 0.34% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.80% 0.10% 0.00% 0.11% NA
Indica Intermediate  786 99.40% 0.40% 0.25% 0.00% NA
Temperate Japonica  767 45.90% 48.50% 5.61% 0.00% NA
Tropical Japonica  504 91.90% 6.50% 1.59% 0.00% NA
Japonica Intermediate  241 80.90% 13.70% 5.39% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 88.90% 8.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819260710 T -> C LOC_Os08g31150.1 upstream_gene_variant ; 3530.0bp to feature; MODIFIER silent_mutation Average:77.823; most accessible tissue: Zhenshan97 young leaf, score: 89.875 N N N N
vg0819260710 T -> C LOC_Os08g31160.1 upstream_gene_variant ; 2780.0bp to feature; MODIFIER silent_mutation Average:77.823; most accessible tissue: Zhenshan97 young leaf, score: 89.875 N N N N
vg0819260710 T -> C LOC_Os08g31160-LOC_Os08g31170 intergenic_region ; MODIFIER silent_mutation Average:77.823; most accessible tissue: Zhenshan97 young leaf, score: 89.875 N N N N
vg0819260710 T -> DEL N N silent_mutation Average:77.823; most accessible tissue: Zhenshan97 young leaf, score: 89.875 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819260710 NA 6.96E-08 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819260710 NA 1.88E-06 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819260710 NA 1.27E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819260710 NA 1.55E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819260710 NA 1.60E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819260710 NA 2.28E-15 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819260710 NA 2.14E-11 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819260710 NA 2.24E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819260710 1.25E-07 4.20E-19 mr1182_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819260710 NA 1.66E-10 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819260710 NA 1.81E-13 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819260710 NA 1.88E-07 mr1282_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819260710 NA 2.07E-06 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819260710 NA 2.14E-08 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819260710 NA 1.66E-07 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819260710 NA 6.88E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251