\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819258196:

Variant ID: vg0819258196 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19258196
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AACACCGGAACTTCCTAGCAGTGATGAGCAGCCCGGAACTTCCGGAGTTCTTCAGACAGGAACTTCCGGGCAACAGAGAAAAACGAAATATGAGAAGTAT[A/T]
ACAGGTCCTAGCTAGTGAAAATCAGGCACAGGGTTGCACAAGATGAAAATCACAAGATACCAGTAGATTCAAACACAGATCAGGCACACGAGAGACAAAG

Reverse complement sequence

CTTTGTCTCTCGTGTGCCTGATCTGTGTTTGAATCTACTGGTATCTTGTGATTTTCATCTTGTGCAACCCTGTGCCTGATTTTCACTAGCTAGGACCTGT[T/A]
ATACTTCTCATATTTCGTTTTTCTCTGTTGCCCGGAAGTTCCTGTCTGAAGAACTCCGGAAGTTCCGGGCTGCTCATCACTGCTAGGAAGTTCCGGTGTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.20% 31.30% 2.05% 4.46% NA
All Indica  2759 87.60% 8.20% 3.01% 1.23% NA
All Japonica  1512 14.00% 74.50% 0.46% 11.04% NA
Aus  269 93.70% 4.80% 1.49% 0.00% NA
Indica I  595 92.40% 1.70% 4.37% 1.51% NA
Indica II  465 94.80% 1.30% 2.58% 1.29% NA
Indica III  913 78.30% 17.90% 2.74% 1.10% NA
Indica Intermediate  786 90.50% 5.90% 2.54% 1.15% NA
Temperate Japonica  767 1.00% 79.10% 0.65% 19.17% NA
Tropical Japonica  504 35.90% 63.90% 0.20% 0.00% NA
Japonica Intermediate  241 9.50% 81.70% 0.41% 8.30% NA
VI/Aromatic  96 9.40% 78.10% 2.08% 10.42% NA
Intermediate  90 53.30% 45.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819258196 A -> T LOC_Os08g31150.1 upstream_gene_variant ; 1016.0bp to feature; MODIFIER silent_mutation Average:32.245; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0819258196 A -> T LOC_Os08g31160.1 upstream_gene_variant ; 266.0bp to feature; MODIFIER silent_mutation Average:32.245; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0819258196 A -> T LOC_Os08g31160-LOC_Os08g31170 intergenic_region ; MODIFIER silent_mutation Average:32.245; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0819258196 A -> DEL N N silent_mutation Average:32.245; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819258196 NA 4.57E-11 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258196 NA 1.91E-32 mr1081 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258196 NA 4.53E-20 mr1102 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258196 NA 6.49E-11 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258196 NA 1.73E-10 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258196 NA 1.64E-23 mr1217 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258196 NA 6.02E-08 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258196 NA 1.48E-30 mr1256 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258196 NA 2.59E-10 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258196 NA 1.34E-11 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258196 NA 1.54E-06 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258196 NA 1.99E-25 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258196 NA 1.73E-16 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258196 NA 1.40E-12 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258196 NA 1.59E-06 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258196 NA 7.36E-06 mr1407 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258196 NA 4.31E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258196 NA 1.73E-16 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258196 2.26E-06 NA mr1434 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258196 NA 7.75E-10 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258196 NA 1.53E-09 mr1575 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258196 NA 1.07E-11 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258196 NA 2.22E-07 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258196 NA 7.74E-08 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258196 NA 1.33E-10 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258196 NA 5.34E-08 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258196 NA 4.79E-22 mr1845 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258196 NA 9.71E-10 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258196 NA 1.77E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258196 NA 9.02E-06 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819258196 NA 3.00E-10 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251