\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819248211:

Variant ID: vg0819248211 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19248211
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


CAATTCCTTCTAGAAAAGACCACAAGTGCAAGTTGCTCTACCTAGGACAACCTCTGAAAACTCAGCACAAGAAACTTTACTCACTTACCTCGTTTGCTTG[T/C]
GGAGGTGAGGAAAACCTTCACAAACTTTCCCGGGACATCCACAAGATCTTTGGAAGCTCACGGGCGACGCCTAACCATCTAGGAGAAGATCTCCAAGAGT

Reverse complement sequence

ACTCTTGGAGATCTTCTCCTAGATGGTTAGGCGTCGCCCGTGAGCTTCCAAAGATCTTGTGGATGTCCCGGGAAAGTTTGTGAAGGTTTTCCTCACCTCC[A/G]
CAAGCAAACGAGGTAAGTGAGTAAAGTTTCTTGTGCTGAGTTTTCAGAGGTTGTCCTAGGTAGAGCAACTTGCACTTGTGGTCTTTTCTAGAAGGAATTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.50% 31.70% 1.82% 0.00% NA
All Indica  2759 94.80% 2.30% 2.94% 0.00% NA
All Japonica  1512 14.10% 85.70% 0.20% 0.00% NA
Aus  269 96.30% 3.70% 0.00% 0.00% NA
Indica I  595 97.60% 1.80% 0.50% 0.00% NA
Indica II  465 97.60% 1.90% 0.43% 0.00% NA
Indica III  913 88.70% 3.50% 7.78% 0.00% NA
Indica Intermediate  786 98.00% 1.40% 0.64% 0.00% NA
Temperate Japonica  767 1.00% 99.00% 0.00% 0.00% NA
Tropical Japonica  504 36.10% 63.50% 0.40% 0.00% NA
Japonica Intermediate  241 9.50% 90.00% 0.41% 0.00% NA
VI/Aromatic  96 7.30% 92.70% 0.00% 0.00% NA
Intermediate  90 53.30% 44.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819248211 T -> C LOC_Os08g31140.1 downstream_gene_variant ; 2451.0bp to feature; MODIFIER silent_mutation Average:33.068; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0819248211 T -> C LOC_Os08g31150.1 downstream_gene_variant ; 1432.0bp to feature; MODIFIER silent_mutation Average:33.068; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0819248211 T -> C LOC_Os08g31140-LOC_Os08g31150 intergenic_region ; MODIFIER silent_mutation Average:33.068; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819248211 NA 4.42E-11 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819248211 NA 2.66E-11 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819248211 NA 6.69E-10 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819248211 NA 1.41E-23 mr1217 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819248211 NA 3.59E-11 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819248211 NA 2.67E-09 mr1368 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819248211 NA 1.67E-23 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819248211 NA 8.03E-15 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819248211 NA 8.03E-15 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819248211 NA 4.66E-09 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819248211 NA 1.42E-09 mr1575 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819248211 NA 6.22E-27 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819248211 NA 1.52E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819248211 NA 8.91E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819248211 NA 7.42E-10 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819248211 NA 5.79E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819248211 NA 2.88E-22 mr1845 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819248211 NA 3.41E-28 mr1922 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819248211 NA 1.84E-13 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819248211 7.40E-06 NA mr1519_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251