\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819202971:

Variant ID: vg0819202971 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19202971
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.83, T: 0.17, others allele: 0.00, population size: 65. )

Flanking Sequence (100 bp) in Reference Genome:


ACCGCAGCGATATCCATCCATCGAGATCCGCGATGTGACGGCTAAGGAGAGGGACGAAAGCTGAAATCCCACAATGCCACGTGGAGGGGCTATTTGCACG[T/C]
GAATCCGCATGGAATTCGGTATAAGAGATACTCTATGTCAAGGAACTCCAAGGAGCAGGATCTCGATTGTTCCCTTGCCTCACCAAGCTAATAACCAGGA

Reverse complement sequence

TCCTGGTTATTAGCTTGGTGAGGCAAGGGAACAATCGAGATCCTGCTCCTTGGAGTTCCTTGACATAGAGTATCTCTTATACCGAATTCCATGCGGATTC[A/G]
CGTGCAAATAGCCCCTCCACGTGGCATTGTGGGATTTCAGCTTTCGTCCCTCTCCTTAGCCGTCACATCGCGGATCTCGATGGATGGATATCGCTGCGGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.90% 28.10% 5.92% 12.06% NA
All Indica  2759 70.50% 1.40% 9.39% 18.74% NA
All Japonica  1512 20.20% 79.30% 0.46% 0.07% NA
Aus  269 71.70% 5.20% 4.46% 18.59% NA
Indica I  595 68.70% 1.50% 9.41% 20.34% NA
Indica II  465 84.50% 0.20% 5.16% 10.11% NA
Indica III  913 64.70% 1.60% 12.60% 21.03% NA
Indica Intermediate  786 70.20% 1.70% 8.14% 19.97% NA
Temperate Japonica  767 12.60% 86.70% 0.65% 0.00% NA
Tropical Japonica  504 31.50% 68.10% 0.20% 0.20% NA
Japonica Intermediate  241 20.30% 79.30% 0.41% 0.00% NA
VI/Aromatic  96 60.40% 39.60% 0.00% 0.00% NA
Intermediate  90 50.00% 45.60% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819202971 T -> C LOC_Os08g31090.1 upstream_gene_variant ; 3687.0bp to feature; MODIFIER silent_mutation Average:62.641; most accessible tissue: Zhenshan97 young leaf, score: 71.497 N N N N
vg0819202971 T -> C LOC_Os08g31080-LOC_Os08g31090 intergenic_region ; MODIFIER silent_mutation Average:62.641; most accessible tissue: Zhenshan97 young leaf, score: 71.497 N N N N
vg0819202971 T -> DEL N N silent_mutation Average:62.641; most accessible tissue: Zhenshan97 young leaf, score: 71.497 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819202971 NA 4.95E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819202971 NA 6.47E-08 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819202971 NA 2.67E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819202971 NA 1.60E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819202971 NA 3.13E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819202971 NA 2.91E-06 mr1450 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819202971 NA 2.56E-09 mr1622 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819202971 NA 1.18E-11 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819202971 NA 1.30E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819202971 NA 1.87E-06 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819202971 NA 1.89E-07 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819202971 NA 7.28E-10 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819202971 NA 5.91E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819202971 NA 5.91E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819202971 NA 4.40E-06 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819202971 NA 1.45E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819202971 NA 1.07E-06 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819202971 NA 1.39E-08 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819202971 NA 5.51E-07 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251