\
| Variant ID: vg0819180192 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 19180192 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TAAATTCTTAAAATATACTCCCTCCGTCCCCAAATATAAGGGATTTTGAACGGATGTGACATTTTTTAAGTGCTACGAATCAGGACAGGGAGCATGTTTA[T/G]
CAATCCCCTCCTATCTCACTTATATTTTAATATTTTAGGACGGAGGGAGTACTTCGTCTAGCAGGCAAATGTTTAGCAATCCCCTCCTATCTCTATTCTC
GAGAATAGAGATAGGAGGGGATTGCTAAACATTTGCCTGCTAGACGAAGTACTCCCTCCGTCCTAAAATATTAAAATATAAGTGAGATAGGAGGGGATTG[A/C]
TAAACATGCTCCCTGTCCTGATTCGTAGCACTTAAAAAATGTCACATCCGTTCAAAATCCCTTATATTTGGGGACGGAGGGAGTATATTTTAAGAATTTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.50% | 10.50% | 2.96% | 0.00% | NA |
| All Indica | 2759 | 98.80% | 0.70% | 0.47% | 0.00% | NA |
| All Japonica | 1512 | 61.40% | 30.80% | 7.80% | 0.00% | NA |
| Aus | 269 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.30% | 1.00% | 1.68% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.90% | 0.80% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 35.20% | 52.90% | 11.86% | 0.00% | NA |
| Tropical Japonica | 504 | 94.20% | 3.80% | 1.98% | 0.00% | NA |
| Japonica Intermediate | 241 | 76.30% | 16.60% | 7.05% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 2.10% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 8.90% | 7.78% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0819180192 | T -> G | LOC_Os08g31070.1 | upstream_gene_variant ; 4178.0bp to feature; MODIFIER | silent_mutation | Average:33.88; most accessible tissue: Callus, score: 59.922 | N | N | N | N |
| vg0819180192 | T -> G | LOC_Os08g31060.1 | intron_variant ; MODIFIER | silent_mutation | Average:33.88; most accessible tissue: Callus, score: 59.922 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0819180192 | NA | 2.48E-07 | mr1002 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819180192 | NA | 1.85E-06 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819180192 | NA | 1.61E-06 | mr1183 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819180192 | NA | 1.64E-06 | mr1503 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819180192 | NA | 2.50E-13 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819180192 | NA | 1.09E-10 | mr1002_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819180192 | NA | 1.31E-13 | mr1182_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819180192 | NA | 7.42E-07 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819180192 | NA | 3.64E-10 | mr1282_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819180192 | NA | 1.13E-06 | mr1330_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819180192 | NA | 7.09E-06 | mr1371_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819180192 | NA | 5.55E-06 | mr1648_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819180192 | NA | 2.24E-08 | mr1794_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819180192 | NA | 4.21E-08 | mr1805_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819180192 | 1.77E-06 | NA | mr1851_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819180192 | NA | 1.60E-06 | mr1851_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819180192 | NA | 1.80E-06 | mr1977_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |