\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819169232:

Variant ID: vg0819169232 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19169232
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCTTTTGATTCAGCGATGACAACCAAGCCCCGTGCAGCGCCGCTGTCCTCGGCTGGCGCGGGCAGCTGCGCAGTGCGACGGTGGTGTCCGCCACCGCGC[C/T]
ATCACACCGCTACCTCGCGCGGAATCCGGTTGTCTCTGCGCCGTAATGGCCGCCATGAAATATTGTGTTCTCAGTGTCATTTTTTGTTCATAGCCACGTG

Reverse complement sequence

CACGTGGCTATGAACAAAAAATGACACTGAGAACACAATATTTCATGGCGGCCATTACGGCGCAGAGACAACCGGATTCCGCGCGAGGTAGCGGTGTGAT[G/A]
GCGCGGTGGCGGACACCACCGTCGCACTGCGCAGCTGCCCGCGCCAGCCGAGGACAGCGGCGCTGCACGGGGCTTGGTTGTCATCGCTGAATCAAAAGGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.20% 33.70% 0.04% 0.00% NA
All Indica  2759 97.30% 2.60% 0.07% 0.00% NA
All Japonica  1512 13.50% 86.50% 0.00% 0.00% NA
Aus  269 72.90% 27.10% 0.00% 0.00% NA
Indica I  595 97.80% 2.20% 0.00% 0.00% NA
Indica II  465 99.10% 0.60% 0.22% 0.00% NA
Indica III  913 95.70% 4.30% 0.00% 0.00% NA
Indica Intermediate  786 97.60% 2.30% 0.13% 0.00% NA
Temperate Japonica  767 0.90% 99.10% 0.00% 0.00% NA
Tropical Japonica  504 35.10% 64.90% 0.00% 0.00% NA
Japonica Intermediate  241 8.30% 91.70% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 45.60% 54.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819169232 C -> T LOC_Os08g31040.1 downstream_gene_variant ; 2505.0bp to feature; MODIFIER silent_mutation Average:66.974; most accessible tissue: Zhenshan97 root, score: 76.749 N N N N
vg0819169232 C -> T LOC_Os08g31060.1 downstream_gene_variant ; 4292.0bp to feature; MODIFIER silent_mutation Average:66.974; most accessible tissue: Zhenshan97 root, score: 76.749 N N N N
vg0819169232 C -> T LOC_Os08g31040-LOC_Os08g31060 intergenic_region ; MODIFIER silent_mutation Average:66.974; most accessible tissue: Zhenshan97 root, score: 76.749 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819169232 NA 6.79E-06 mr1039 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819169232 2.33E-06 NA mr1266 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819169232 7.19E-08 7.19E-08 mr1266 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819169232 NA 2.80E-06 mr1345 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819169232 NA 2.91E-09 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819169232 NA 4.29E-14 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819169232 NA 4.29E-14 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819169232 2.79E-06 NA mr1483 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819169232 NA 1.51E-09 mr1575 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819169232 NA 1.69E-06 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819169232 NA 4.68E-06 mr1700 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819169232 NA 4.53E-10 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819169232 NA 9.01E-07 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819169232 NA 5.46E-08 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251