Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819169232:

Variant ID: vg0819169232 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 19169232
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCCTTTTGATTCAGCGATGACAACCAAGCCCCGTGCAGCGCCGCTGTCCTCGGCTGGCGCGGGCAGCTGCGCAGTGCGACGGTGGTGTCCGCCACCGCGC[C/T]
ATCACACCGCTACCTCGCGCGGAATCCGGTTGTCTCTGCGCCGTAATGGCCGCCATGAAATATTGTGTTCTCAGTGTCATTTTTTGTTCATAGCCACGTG

Reverse complement sequence

CACGTGGCTATGAACAAAAAATGACACTGAGAACACAATATTTCATGGCGGCCATTACGGCGCAGAGACAACCGGATTCCGCGCGAGGTAGCGGTGTGAT[G/A]
GCGCGGTGGCGGACACCACCGTCGCACTGCGCAGCTGCCCGCGCCAGCCGAGGACAGCGGCGCTGCACGGGGCTTGGTTGTCATCGCTGAATCAAAAGGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.20%	33.70%	0.04%	0.00%	NA
All Indica	2759	97.30%	2.60%	0.07%	0.00%	NA
All Japonica	1512	13.50%	86.50%	0.00%	0.00%	NA
Aus	269	72.90%	27.10%	0.00%	0.00%	NA
Indica I	595	97.80%	2.20%	0.00%	0.00%	NA
Indica II	465	99.10%	0.60%	0.22%	0.00%	NA
Indica III	913	95.70%	4.30%	0.00%	0.00%	NA
Indica Intermediate	786	97.60%	2.30%	0.13%	0.00%	NA
Temperate Japonica	767	0.90%	99.10%	0.00%	0.00%	NA
Tropical Japonica	504	35.10%	64.90%	0.00%	0.00%	NA
Japonica Intermediate	241	8.30%	91.70%	0.00%	0.00%	NA
VI/Aromatic	96	4.20%	95.80%	0.00%	0.00%	NA
Intermediate	90	45.60%	54.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0819169232	C -> T	LOC_Os08g31040.1	downstream_gene_variant ; 2505.0bp to feature; MODIFIER	silent_mutation	Average:66.974; most accessible tissue: Zhenshan97 root, score: 76.749	N	N	N	N
vg0819169232	C -> T	LOC_Os08g31060.1	downstream_gene_variant ; 4292.0bp to feature; MODIFIER	silent_mutation	Average:66.974; most accessible tissue: Zhenshan97 root, score: 76.749	N	N	N	N
vg0819169232	C -> T	LOC_Os08g31040-LOC_Os08g31060	intergenic_region ; MODIFIER	silent_mutation	Average:66.974; most accessible tissue: Zhenshan97 root, score: 76.749	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0819169232	NA	6.79E-06	mr1039	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819169232	2.33E-06	NA	mr1266	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819169232	7.19E-08	7.19E-08	mr1266	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819169232	NA	2.80E-06	mr1345	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819169232	NA	2.91E-09	mr1352	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819169232	NA	4.29E-14	mr1376	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819169232	NA	4.29E-14	mr1431	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819169232	2.79E-06	NA	mr1483	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819169232	NA	1.51E-09	mr1575	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819169232	NA	1.69E-06	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819169232	NA	4.68E-06	mr1700	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819169232	NA	4.53E-10	mr1714	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819169232	NA	9.01E-07	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819169232	NA	5.46E-08	mr1047_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251