\
| Variant ID: vg0819150140 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 19150140 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 263. )
GGCGCGGGAGGAAGGATCAAATCAAGTGGGCCGTCGGCTACCGCTCGGCCCAGACGGGAGAGGCGTGACAACCCGCACGTGAAGGGGAAGGATTGGGTCC[A/T]
GTAGCTTCGGGCAAGGTCTATAAATAGATTACCCTTGTACTGAAAGAGGTGAACTGTATTGAACAAACATATTCTAAATACCAATCCTTTCCCCCTCTCC
GGAGAGGGGGAAAGGATTGGTATTTAGAATATGTTTGTTCAATACAGTTCACCTCTTTCAGTACAAGGGTAATCTATTTATAGACCTTGCCCGAAGCTAC[T/A]
GGACCCAATCCTTCCCCTTCACGTGCGGGTTGTCACGCCTCTCCCGTCTGGGCCGAGCGGTAGCCGACGGCCCACTTGATTTGATCCTTCCTCCCGCGCC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.50% | 5.80% | 1.76% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.20% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 77.30% | 17.50% | 5.22% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.70% | 0.17% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 71.30% | 20.10% | 8.60% | 0.00% | NA |
| Tropical Japonica | 504 | 95.40% | 4.20% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 58.50% | 36.90% | 4.56% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 3.30% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0819150140 | A -> T | LOC_Os08g31010.1 | missense_variant ; p.Gln1346Leu; MODERATE | nonsynonymous_codon ; Q1346L | Average:43.333; most accessible tissue: Minghui63 panicle, score: 56.842 | unknown | unknown | TOLERATED | 0.08 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0819150140 | 3.05E-06 | NA | mr1371_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819150140 | 2.45E-06 | NA | mr1397_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819150140 | 8.97E-06 | NA | mr1445_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819150140 | 3.47E-06 | 3.47E-06 | mr1499_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819150140 | 3.08E-06 | NA | mr1645_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819150140 | 1.29E-07 | NA | mr1647_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819150140 | 2.51E-06 | 2.51E-06 | mr1647_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819150140 | 3.75E-06 | 3.75E-06 | mr1655_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819150140 | NA | 9.18E-06 | mr1861_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819150140 | 2.90E-06 | NA | mr1970_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819150140 | 2.39E-06 | NA | mr1977_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |