\
| Variant ID: vg0819146214 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 19146214 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTGCTTATGATCCTATGTACAATCAGCTCATGATTGTGCATAGGTTCACTGAAGGGTTGCGTTTTGACATTCGTCATGCTGTTATGATGCAACGTCCTCG[C/A]
GACCTAGAGACTACTCTGGCTATTGCTTGTTTACAGGAGGAATGGATGGAGACTCAGAAGCCCAAGGAATTTCGTAAATTGGGTGATCATGTTCCGCGGA
TCCGCGGAACATGATCACCCAATTTACGAAATTCCTTGGGCTTCTGAGTCTCCATCCATTCCTCCTGTAAACAAGCAATAGCCAGAGTAGTCTCTAGGTC[G/T]
CGAGGACGTTGCATCATAACAGCATGACGAATGTCAAAACGCAACCCTTCAGTGAACCTATGCACAATCATGAGCTGATTGTACATAGGATCATAAGCAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.40% | 2.30% | 2.26% | 0.00% | NA |
| All Indica | 2759 | 98.20% | 0.90% | 0.87% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 39.00% | 30.50% | 30.48% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.30% | 0.90% | 0.86% | 0.00% | NA |
| Indica III | 913 | 98.80% | 0.50% | 0.66% | 0.00% | NA |
| Indica Intermediate | 786 | 96.20% | 2.00% | 1.78% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 1.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0819146214 | C -> A | LOC_Os08g31010.1 | synonymous_variant ; p.Arg321Arg; LOW | synonymous_codon | Average:19.941; most accessible tissue: Zhenshan97 root, score: 30.989 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0819146214 | NA | 4.44E-15 | mr1113 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819146214 | NA | 3.40E-19 | mr1114 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819146214 | NA | 1.15E-18 | mr1117 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819146214 | NA | 8.90E-23 | mr1123 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819146214 | NA | 1.61E-14 | mr1496 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819146214 | 9.50E-08 | 5.92E-40 | mr1549 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819146214 | 6.85E-08 | 3.21E-45 | mr1550 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819146214 | 1.64E-07 | 8.13E-42 | mr1757 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819146214 | NA | 2.10E-31 | mr1549_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819146214 | NA | 3.60E-46 | mr1550_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819146214 | NA | 9.92E-28 | mr1757_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |