Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819138103:

Variant ID: vg0819138103 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 19138103
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGAGTTGGATGTGGAGGAGGGCCTGTAGAGGACAAGACCAACCCCTATATAAGGGACATGGCTGGTTCATTGTAAAAAACCAATCTACAATCAATCAATC[A/G]
AATCGTTTTTCATATTGCTTTCAGTTTTCTCTTAGTTTGTCCATCTTTGTCGGTTTGCACCGTAAACTGTCCGCCGCCGTTGCGAGAGTGCGACATTTCT

Reverse complement sequence

AGAAATGTCGCACTCTCGCAACGGCGGCGGACAGTTTACGGTGCAAACCGACAAAGATGGACAAACTAAGAGAAAACTGAAAGCAATATGAAAAACGATT[T/C]
GATTGATTGATTGTAGATTGGTTTTTTACAATGAACCAGCCATGTCCCTTATATAGGGGTTGGTCTTGTCCTCTACAGGCCCTCCTCCACATCCAACTCG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.00%	28.60%	0.40%	0.00%	NA
All Indica	2759	97.40%	2.00%	0.58%	0.00%	NA
All Japonica	1512	20.40%	79.40%	0.20%	0.00%	NA
Aus	269	93.30%	6.70%	0.00%	0.00%	NA
Indica I	595	97.80%	1.80%	0.34%	0.00%	NA
Indica II	465	99.10%	0.60%	0.22%	0.00%	NA
Indica III	913	96.30%	2.40%	1.31%	0.00%	NA
Indica Intermediate	786	97.50%	2.40%	0.13%	0.00%	NA
Temperate Japonica	767	11.00%	88.90%	0.13%	0.00%	NA
Tropical Japonica	504	34.90%	64.70%	0.40%	0.00%	NA
Japonica Intermediate	241	20.30%	79.70%	0.00%	0.00%	NA
VI/Aromatic	96	63.50%	36.50%	0.00%	0.00%	NA
Intermediate	90	53.30%	46.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0819138103	A -> G	LOC_Os08g31000.1	upstream_gene_variant ; 1506.0bp to feature; MODIFIER	silent_mutation	Average:58.456; most accessible tissue: Minghui63 panicle, score: 86.012	N	N	N	N
vg0819138103	A -> G	LOC_Os08g30990.1	downstream_gene_variant ; 472.0bp to feature; MODIFIER	silent_mutation	Average:58.456; most accessible tissue: Minghui63 panicle, score: 86.012	N	N	N	N
vg0819138103	A -> G	LOC_Os08g30990-LOC_Os08g31000	intergenic_region ; MODIFIER	silent_mutation	Average:58.456; most accessible tissue: Minghui63 panicle, score: 86.012	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0819138103	NA	1.04E-06	mr1057	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819138103	NA	2.10E-08	mr1227	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819138103	2.27E-06	2.27E-06	mr1266	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819138103	NA	6.42E-06	mr1418	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819138103	NA	2.72E-07	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819138103	NA	6.15E-12	mr1636	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819138103	NA	4.00E-07	mr1677	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819138103	NA	1.52E-13	mr1940	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819138103	NA	1.40E-06	mr1940	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819138103	NA	2.46E-07	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251