Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819129563:

Variant ID: vg0819129563 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 19129563
Reference Allele: T	Alternative Allele: C,A
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGGTCAGACCGTCGGTTGAGGGCCGGTCAGACCGGCGGTGTGTGGCCGGTCTAACCGGCAGGTCCGAGTCCGACTGCGTTTCGTCGGGTTTCGAGGTTTC[T/C,A]
TTGCTCGGGAAGGCATGTTTCGGGTTTCCTTTAGTTTCTACCCCGAGTTGGACATGGAGGAGGGCCTGTAGAAGGCAAGACCAACCCCTATATAAGGGAC

Reverse complement sequence

GTCCCTTATATAGGGGTTGGTCTTGCCTTCTACAGGCCCTCCTCCATGTCCAACTCGGGGTAGAAACTAAAGGAAACCCGAAACATGCCTTCCCGAGCAA[A/G,T]
GAAACCTCGAAACCCGACGAAACGCAGTCGGACTCGGACCTGCCGGTTAGACCGGCCACACACCGCCGGTCTGACCGGCCCTCAACCGACGGTCTGACCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.10%	32.30%	0.55%	0.00%	NA
All Indica	2759	96.60%	2.70%	0.76%	0.00%	NA
All Japonica	1512	13.40%	86.40%	0.20%	0.00%	NA
Aus	269	93.70%	6.30%	0.00%	0.00%	NA
Indica I	595	97.10%	2.20%	0.67%	0.00%	NA
Indica II	465	98.50%	1.10%	0.43%	0.00%	NA
Indica III	913	94.30%	4.30%	1.42%	0.00%	NA
Indica Intermediate	786	97.60%	2.20%	0.25%	0.00%	NA
Temperate Japonica	767	0.90%	99.00%	0.13%	0.00%	NA
Tropical Japonica	504	34.50%	65.10%	0.40%	0.00%	NA
Japonica Intermediate	241	8.70%	91.30%	0.00%	0.00%	NA
VI/Aromatic	96	10.40%	89.60%	0.00%	0.00%	NA
Intermediate	90	48.90%	48.90%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0819129563	T -> C	LOC_Os08g30990.1	upstream_gene_variant ; 507.0bp to feature; MODIFIER	silent_mutation	Average:58.135; most accessible tissue: Zhenshan97 flag leaf, score: 73.119	N	N	N	N
vg0819129563	T -> C	LOC_Os08g30980.1	downstream_gene_variant ; 1836.0bp to feature; MODIFIER	silent_mutation	Average:58.135; most accessible tissue: Zhenshan97 flag leaf, score: 73.119	N	N	N	N
vg0819129563	T -> C	LOC_Os08g30980-LOC_Os08g30990	intergenic_region ; MODIFIER	silent_mutation	Average:58.135; most accessible tissue: Zhenshan97 flag leaf, score: 73.119	N	N	N	N
vg0819129563	T -> A	LOC_Os08g30990.1	upstream_gene_variant ; 507.0bp to feature; MODIFIER	N	Average:58.135; most accessible tissue: Zhenshan97 flag leaf, score: 73.119	N	N	N	N
vg0819129563	T -> A	LOC_Os08g30980.1	downstream_gene_variant ; 1836.0bp to feature; MODIFIER	N	Average:58.135; most accessible tissue: Zhenshan97 flag leaf, score: 73.119	N	N	N	N
vg0819129563	T -> A	LOC_Os08g30980-LOC_Os08g30990	intergenic_region ; MODIFIER	N	Average:58.135; most accessible tissue: Zhenshan97 flag leaf, score: 73.119	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0819129563	NA	6.79E-06	mr1039	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819129563	NA	2.41E-10	mr1070	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819129563	NA	2.41E-26	mr1130	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819129563	NA	2.16E-23	mr1217	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819129563	7.63E-06	2.35E-09	mr1227	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819129563	NA	8.73E-22	mr1254	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819129563	1.02E-07	NA	mr1266	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819129563	7.19E-08	7.19E-08	mr1266	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819129563	NA	5.64E-10	mr1275	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819129563	NA	1.48E-07	mr1278	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819129563	NA	1.94E-08	mr1302	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819129563	NA	3.76E-11	mr1307	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819129563	NA	3.05E-07	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819129563	2.66E-06	NA	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819129563	NA	2.80E-06	mr1345	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819129563	NA	5.53E-24	mr1375	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819129563	NA	3.15E-16	mr1376	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819129563	NA	8.35E-13	mr1386	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819129563	NA	6.57E-07	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819129563	NA	7.16E-06	mr1418	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819129563	NA	1.68E-06	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819129563	NA	3.15E-16	mr1431	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819129563	NA	2.38E-09	mr1442	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819129563	NA	5.94E-06	mr1461	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819129563	3.10E-07	NA	mr1501	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819129563	NA	8.97E-06	mr1508	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819129563	NA	5.18E-10	mr1575	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819129563	NA	6.73E-08	mr1604	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819129563	NA	2.74E-07	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819129563	4.73E-06	NA	mr1634	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819129563	NA	9.53E-13	mr1636	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819129563	NA	1.47E-06	mr1646	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819129563	NA	5.61E-06	mr1681	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819129563	NA	2.93E-11	mr1683	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819129563	NA	4.68E-06	mr1700	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819129563	NA	7.39E-11	mr1714	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819129563	NA	1.03E-08	mr1776	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819129563	NA	6.80E-08	mr1810	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819129563	NA	3.97E-22	mr1845	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819129563	NA	3.57E-07	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819129563	NA	3.10E-07	mr1886	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819129563	NA	6.11E-13	mr1924	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819129563	NA	2.61E-13	mr1940	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819129563	NA	5.46E-08	mr1047_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819129563	NA	2.13E-06	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251