\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819123966:

Variant ID: vg0819123966 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19123966
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATATTCTTCTGTTACTACAAAATTCGCCATGTTGTTAGTGCCAAACAACCTATAAATTTTGCAGTAACGTATCGTGTTATTATCCTTCTATTGTAATGTT[A/C]
CTGCCAAATCATAGTAAAAAGGTATGATTCTTGCAATAACATAACTAAATAATTTGTTATCATAAAATTTGGACATTCATACAAAGCAAGCAAACAATTA

Reverse complement sequence

TAATTGTTTGCTTGCTTTGTATGAATGTCCAAATTTTATGATAACAAATTATTTAGTTATGTTATTGCAAGAATCATACCTTTTTACTATGATTTGGCAG[T/G]
AACATTACAATAGAAGGATAATAACACGATACGTTACTGCAAAATTTATAGGTTGTTTGGCACTAACAACATGGCGAATTTTGTAGTAACAGAAGAATAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.50% 4.70% 0.40% 36.39% NA
All Indica  2759 36.70% 2.10% 0.62% 60.53% NA
All Japonica  1512 98.60% 0.10% 0.00% 1.26% NA
Aus  269 40.10% 57.60% 0.00% 2.23% NA
Indica I  595 11.90% 0.00% 1.01% 87.06% NA
Indica II  465 12.00% 1.90% 0.43% 85.59% NA
Indica III  913 59.30% 1.40% 0.44% 38.88% NA
Indica Intermediate  786 43.90% 4.70% 0.64% 50.76% NA
Temperate Japonica  767 99.20% 0.10% 0.00% 0.65% NA
Tropical Japonica  504 97.80% 0.00% 0.00% 2.18% NA
Japonica Intermediate  241 98.30% 0.40% 0.00% 1.24% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 64.40% 5.60% 2.22% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819123966 A -> C LOC_Os08g30970.1 upstream_gene_variant ; 4020.0bp to feature; MODIFIER silent_mutation Average:52.56; most accessible tissue: Callus, score: 84.661 N N N N
vg0819123966 A -> C LOC_Os08g30980.1 upstream_gene_variant ; 466.0bp to feature; MODIFIER silent_mutation Average:52.56; most accessible tissue: Callus, score: 84.661 N N N N
vg0819123966 A -> C LOC_Os08g30970-LOC_Os08g30980 intergenic_region ; MODIFIER silent_mutation Average:52.56; most accessible tissue: Callus, score: 84.661 N N N N
vg0819123966 A -> DEL N N silent_mutation Average:52.56; most accessible tissue: Callus, score: 84.661 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819123966 6.45E-06 8.23E-27 mr1099 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819123966 NA 8.08E-16 mr1113 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819123966 6.32E-06 5.29E-19 mr1114 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819123966 5.07E-07 6.98E-22 mr1117 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819123966 7.02E-06 NA mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819123966 NA 1.32E-17 mr1119 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819123966 6.20E-06 1.82E-22 mr1120 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819123966 4.90E-08 3.09E-27 mr1123 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819123966 NA 3.63E-17 mr1240 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819123966 1.78E-06 8.08E-19 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819123966 NA 2.33E-21 mr1247 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819123966 NA 8.59E-06 mr1393 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819123966 1.74E-07 5.56E-17 mr1496 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819123966 NA 2.68E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819123966 NA 5.65E-06 mr1344_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819123966 NA 4.17E-22 mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819123966 NA 2.65E-15 mr1961_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251