Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0819113697:

Variant ID: vg0819113697 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 19113697
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCATATCCAGCTCGGCGTTGCATTCTTCAAGTTGTGCCAAGAGTTCAATCTTACGAGCTTCGAGCCGATCAATGTTAGATTTAATCGGGCCCTCAGATAG[T/C]
TGATCAAGTTTGGCCTTCTCTTCATGAACAAGCTATCAATTGGCCTGGATTGTGGCCTCGATATCCTTGCGCTCCCGACGTTTAGCTAATCTCAGCTTGG

Reverse complement sequence

CCAAGCTGAGATTAGCTAAACGTCGGGAGCGCAAGGATATCGAGGCCACAATCCAGGCCAATTGATAGCTTGTTCATGAAGAGAAGGCCAAACTTGATCA[A/G]
CTATCTGAGGGCCCGATTAAATCTAACATTGATCGGCTCGAAGCTCGTAAGATTGAACTCTTGGCACAACTTGAAGAATGCAACGCCGAGCTGGATATGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.40%	0.60%	8.51%	54.44%	NA
All Indica	2759	8.80%	1.10%	13.08%	77.09%	NA
All Japonica	1512	86.80%	0.00%	0.40%	12.76%	NA
Aus	269	10.80%	0.00%	12.27%	76.95%	NA
Indica I	595	12.80%	0.00%	5.04%	82.18%	NA
Indica II	465	5.20%	0.00%	6.02%	88.82%	NA
Indica III	913	7.00%	3.10%	19.61%	70.32%	NA
Indica Intermediate	786	9.90%	0.10%	15.78%	74.17%	NA
Temperate Japonica	767	99.10%	0.00%	0.00%	0.91%	NA
Tropical Japonica	504	66.10%	0.00%	0.99%	32.94%	NA
Japonica Intermediate	241	91.30%	0.00%	0.41%	8.30%	NA
VI/Aromatic	96	92.70%	0.00%	0.00%	7.29%	NA
Intermediate	90	54.40%	0.00%	2.22%	43.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0819113697	T -> C	LOC_Os08g30950.1	downstream_gene_variant ; 3447.0bp to feature; MODIFIER	silent_mutation	Average:9.261; most accessible tissue: Callus, score: 44.854	N	N	N	N
vg0819113697	T -> C	LOC_Os08g30960.1	downstream_gene_variant ; 36.0bp to feature; MODIFIER	silent_mutation	Average:9.261; most accessible tissue: Callus, score: 44.854	N	N	N	N
vg0819113697	T -> C	LOC_Os08g30950-LOC_Os08g30960	intergenic_region ; MODIFIER	silent_mutation	Average:9.261; most accessible tissue: Callus, score: 44.854	N	N	N	N
vg0819113697	T -> DEL	N	N	silent_mutation	Average:9.261; most accessible tissue: Callus, score: 44.854	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0819113697	NA	6.44E-06	mr1044	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819113697	NA	2.61E-08	mr1277	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819113697	NA	2.56E-06	mr1418	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819113697	NA	2.29E-07	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819113697	NA	5.27E-08	mr1609	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819113697	NA	5.28E-06	mr1884	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819113697	NA	2.20E-11	mr1921	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251