\
| Variant ID: vg0819104472 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 19104472 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, C: 0.02, others allele: 0.00, population size: 53. )
TGTTGATTGTAGGATCAAATCAACTGGCACGCTTGCATACCCGAAGGCGAGTTTTGGACCTGCACTGGAGTTAAGCAGATATCCCAGGCCTCGTGTTTTA[T/C]
GTCAACACGCTTTTGGTACGCCTGGTGGGACAGATCAGAAGTCAGAATCACAACAACAGTTTTTCCCATGGCCGAGAAACCGCCAGCATCGCCGTCCTCG
CGAGGACGGCGATGCTGGCGGTTTCTCGGCCATGGGAAAAACTGTTGTTGTGATTCTGACTTCTGATCTGTCCCACCAGGCGTACCAAAAGCGTGTTGAC[A/G]
TAAAACACGAGGCCTGGGATATCTGCTTAACTCCAGTGCAGGTCCAAAACTCGCCTTCGGGTATGCAAGCGTGCCAGTTGATTTGATCCTACAATCAACA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.30% | 9.90% | 19.51% | 4.32% | NA |
| All Indica | 2759 | 54.40% | 16.20% | 26.86% | 2.57% | NA |
| All Japonica | 1512 | 87.90% | 0.30% | 3.04% | 8.80% | NA |
| Aus | 269 | 52.00% | 3.70% | 44.24% | 0.00% | NA |
| Indica I | 595 | 51.60% | 6.60% | 39.16% | 2.69% | NA |
| Indica II | 465 | 35.50% | 28.60% | 32.90% | 3.01% | NA |
| Indica III | 913 | 63.20% | 16.50% | 17.74% | 2.52% | NA |
| Indica Intermediate | 786 | 57.40% | 15.80% | 24.55% | 2.29% | NA |
| Temperate Japonica | 767 | 99.60% | 0.00% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 67.90% | 0.60% | 8.33% | 23.21% | NA |
| Japonica Intermediate | 241 | 92.50% | 0.40% | 0.41% | 6.64% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 5.60% | 15.56% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0819104472 | T -> C | LOC_Os08g30940.1 | missense_variant ; p.Cys96Arg; MODERATE | nonsynonymous_codon ; C96H | Average:24.421; most accessible tissue: Minghui63 root, score: 35.002 | unknown | unknown | TOLERATED | 0.56 |
| vg0819104472 | T -> C | LOC_Os08g30940.1 | missense_variant ; p.Cys96Arg; MODERATE | nonsynonymous_codon ; C96R | Average:24.421; most accessible tissue: Minghui63 root, score: 35.002 | unknown | unknown | TOLERATED | 0.46 |
| vg0819104472 | T -> DEL | LOC_Os08g30940.1 | N | frameshift_variant | Average:24.421; most accessible tissue: Minghui63 root, score: 35.002 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0819104472 | NA | 6.79E-06 | mr1039 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819104472 | NA | 2.72E-23 | mr1217 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819104472 | 4.74E-06 | 1.51E-09 | mr1227 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819104472 | NA | 8.71E-29 | mr1256 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819104472 | 7.19E-08 | 7.19E-08 | mr1266 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819104472 | NA | 2.98E-09 | mr1275 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819104472 | NA | 1.74E-10 | mr1307 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819104472 | NA | 2.80E-06 | mr1345 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819104472 | NA | 2.42E-12 | mr1386 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819104472 | NA | 1.58E-08 | mr1607 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819104472 | NA | 1.46E-06 | mr1622 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819104472 | NA | 4.68E-06 | mr1700 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819104472 | NA | 2.13E-21 | mr1845 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819104472 | NA | 1.25E-06 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819104472 | NA | 1.34E-13 | mr1940 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819104472 | NA | 5.46E-08 | mr1047_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819104472 | 4.47E-06 | NA | mr1520_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |