\
| Variant ID: vg0819103697 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 19103697 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CGAGTTATCATATATCTTACATAATCTCTAGCAATATCGCTATCTAACCTACAATCGGCTAACATCTGTCGGTAGAGGGCAACCGATTAGGTTAGACATC[A/G]
ATGTTGACTTAGATTATATAGGATATTCACCACTCTATGAAACTTTCAATGGCTTGATTGTCTAGATATTGTCCTTCTTTTCATACTTATAGCTGCATCA
TGATGCAGCTATAAGTATGAAAAGAAGGACAATATCTAGACAATCAAGCCATTGAAAGTTTCATAGAGTGGTGAATATCCTATATAATCTAAGTCAACAT[T/C]
GATGTCTAACCTAATCGGTTGCCCTCTACCGACAGATGTTAGCCGATTGTAGGTTAGATAGCGATATTGCTAGAGATTATGTAAGATATATGATAACTCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.00% | 33.00% | 1.02% | 0.00% | NA |
| All Indica | 2759 | 95.00% | 3.70% | 1.34% | 0.00% | NA |
| All Japonica | 1512 | 13.40% | 86.50% | 0.13% | 0.00% | NA |
| Aus | 269 | 91.10% | 7.10% | 1.86% | 0.00% | NA |
| Indica I | 595 | 95.00% | 3.90% | 1.18% | 0.00% | NA |
| Indica II | 465 | 97.80% | 1.70% | 0.43% | 0.00% | NA |
| Indica III | 913 | 93.20% | 4.60% | 2.19% | 0.00% | NA |
| Indica Intermediate | 786 | 95.40% | 3.60% | 1.02% | 0.00% | NA |
| Temperate Japonica | 767 | 0.80% | 99.10% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 34.70% | 65.10% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 8.70% | 91.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 8.30% | 89.60% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 47.80% | 50.00% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0819103697 | A -> G | LOC_Os08g30940.1 | upstream_gene_variant ; 447.0bp to feature; MODIFIER | silent_mutation | Average:14.943; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg0819103697 | A -> G | LOC_Os08g30950.1 | upstream_gene_variant ; 3753.0bp to feature; MODIFIER | silent_mutation | Average:14.943; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg0819103697 | A -> G | LOC_Os08g30930.1 | downstream_gene_variant ; 4757.0bp to feature; MODIFIER | silent_mutation | Average:14.943; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg0819103697 | A -> G | LOC_Os08g30930-LOC_Os08g30940 | intergenic_region ; MODIFIER | silent_mutation | Average:14.943; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0819103697 | NA | 6.79E-06 | mr1039 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | 9.18E-06 | NA | mr1058 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 5.71E-06 | mr1066 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 3.60E-11 | mr1070 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 3.45E-11 | mr1084 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 1.32E-10 | mr1128 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 3.52E-09 | mr1198 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 5.23E-23 | mr1217 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | 4.31E-06 | 9.36E-09 | mr1227 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 2.47E-21 | mr1254 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | 3.39E-08 | NA | mr1266 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | 7.19E-08 | 7.19E-08 | mr1266 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 2.64E-10 | mr1275 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 2.39E-07 | mr1278 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | 4.84E-06 | NA | mr1290 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 4.27E-09 | mr1302 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 1.28E-10 | mr1307 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 6.27E-17 | mr1308 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 1.45E-07 | mr1315 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | 1.53E-07 | NA | mr1345 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 2.80E-06 | mr1345 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 4.25E-10 | mr1368 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 7.13E-23 | mr1375 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 1.92E-17 | mr1376 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 8.74E-13 | mr1386 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 2.60E-07 | mr1392 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | 8.08E-06 | NA | mr1393 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 5.04E-06 | mr1418 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 1.47E-06 | mr1420 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 4.84E-06 | mr1424 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | 8.64E-06 | NA | mr1427 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 1.92E-17 | mr1431 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 9.59E-10 | mr1442 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 9.30E-06 | mr1450 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 4.99E-08 | mr1488 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 8.96E-08 | mr1506 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 4.56E-06 | mr1508 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 7.54E-41 | mr1509 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 8.46E-11 | mr1575 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 3.32E-37 | mr1601 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 2.61E-08 | mr1604 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 2.72E-07 | mr1622 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | 9.96E-07 | NA | mr1634 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 1.50E-12 | mr1636 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 4.36E-07 | mr1646 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 3.92E-14 | mr1653 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 1.78E-07 | mr1659 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 2.98E-06 | mr1681 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 4.68E-06 | mr1700 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 6.43E-11 | mr1714 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 1.23E-10 | mr1775 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 2.83E-09 | mr1776 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 3.87E-07 | mr1797 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 3.87E-07 | mr1801 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 1.47E-08 | mr1810 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 2.25E-15 | mr1830 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 7.81E-22 | mr1845 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | 9.55E-06 | NA | mr1852 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 4.05E-07 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 7.28E-08 | mr1886 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 3.79E-10 | mr1921 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 3.45E-13 | mr1924 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 3.68E-15 | mr1933 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 7.17E-14 | mr1940 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819103697 | NA | 5.46E-08 | mr1047_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |