Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0819094093:

Variant ID: vg0819094093 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 19094093
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACTTCTTATTTCTATAAAAATATTTATTGTAAAGTGATATATGTATACTTTTATGAAAGTATTTTTCAAGACAAATCTATTCATATAGTTTTTATATTTT[T/C]
AAACTCAACAACTTGAGAGTTATTCATGATTTATATTCCTAAGGTTTAACTTAAATATTATCCTAAACGACTTCCTTTACAAGTACGGGGGAGTACGCCT

Reverse complement sequence

AGGCGTACTCCCCCGTACTTGTAAAGGAAGTCGTTTAGGATAATATTTAAGTTAAACCTTAGGAATATAAATCATGAATAACTCTCAAGTTGTTGAGTTT[A/G]
AAAATATAAAAACTATATGAATAGATTTGTCTTGAAAAATACTTTCATAAAAGTATACATATATCACTTTACAATAAATATTTTTATAGAAATAAGAAGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.70%	28.00%	0.36%	0.00%	NA
All Indica	2759	98.30%	1.20%	0.51%	0.00%	NA
All Japonica	1512	20.80%	79.20%	0.07%	0.00%	NA
Aus	269	93.70%	6.30%	0.00%	0.00%	NA
Indica I	595	96.80%	1.70%	1.51%	0.00%	NA
Indica II	465	98.90%	0.60%	0.43%	0.00%	NA
Indica III	913	99.20%	0.80%	0.00%	0.00%	NA
Indica Intermediate	786	97.80%	1.80%	0.38%	0.00%	NA
Temperate Japonica	767	11.00%	88.90%	0.13%	0.00%	NA
Tropical Japonica	504	35.50%	64.50%	0.00%	0.00%	NA
Japonica Intermediate	241	21.20%	78.80%	0.00%	0.00%	NA
VI/Aromatic	96	64.60%	35.40%	0.00%	0.00%	NA
Intermediate	90	53.30%	44.40%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0819094093	T -> C	LOC_Os08g30930.1	upstream_gene_variant ; 632.0bp to feature; MODIFIER	silent_mutation	Average:39.621; most accessible tissue: Zhenshan97 flower, score: 59.755	N	N	N	N
vg0819094093	T -> C	LOC_Os08g30910.1	downstream_gene_variant ; 4596.0bp to feature; MODIFIER	silent_mutation	Average:39.621; most accessible tissue: Zhenshan97 flower, score: 59.755	N	N	N	N
vg0819094093	T -> C	LOC_Os08g30910-LOC_Os08g30930	intergenic_region ; MODIFIER	silent_mutation	Average:39.621; most accessible tissue: Zhenshan97 flower, score: 59.755	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0819094093	NA	3.20E-07	mr1227	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093	NA	3.33E-07	mr1245	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093	NA	5.83E-09	mr1275	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093	NA	1.09E-06	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093	NA	2.36E-06	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093	NA	1.61E-07	mr1418	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093	NA	3.84E-08	mr1420	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093	NA	7.06E-09	mr1488	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093	NA	8.72E-06	mr1559	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093	NA	7.35E-08	mr1604	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093	NA	9.71E-08	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093	NA	1.94E-12	mr1636	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093	NA	2.58E-13	mr1641	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093	NA	1.71E-07	mr1646	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093	NA	1.10E-13	mr1653	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093	NA	2.33E-06	mr1677	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093	NA	6.48E-06	mr1681	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093	NA	1.32E-10	mr1683	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093	NA	7.83E-06	mr1773	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093	NA	3.87E-09	mr1776	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093	NA	8.59E-08	mr1797	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093	NA	8.59E-08	mr1801	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093	NA	5.11E-06	mr1832	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093	NA	5.25E-07	mr1886	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093	NA	1.13E-13	mr1909	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093	NA	3.97E-11	mr1921	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093	NA	1.44E-12	mr1940	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251