Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819094093:

Variant ID: vg0819094093 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19094093
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTTCTTATTTCTATAAAAATATTTATTGTAAAGTGATATATGTATACTTTTATGAAAGTATTTTTCAAGACAAATCTATTCATATAGTTTTTATATTTT[T/C]
AAACTCAACAACTTGAGAGTTATTCATGATTTATATTCCTAAGGTTTAACTTAAATATTATCCTAAACGACTTCCTTTACAAGTACGGGGGAGTACGCCT

Reverse complement sequence

AGGCGTACTCCCCCGTACTTGTAAAGGAAGTCGTTTAGGATAATATTTAAGTTAAACCTTAGGAATATAAATCATGAATAACTCTCAAGTTGTTGAGTTT[A/G]
AAAATATAAAAACTATATGAATAGATTTGTCTTGAAAAATACTTTCATAAAAGTATACATATATCACTTTACAATAAATATTTTTATAGAAATAAGAAGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.70% 28.00% 0.36% 0.00% NA
All Indica  2759 98.30% 1.20% 0.51% 0.00% NA
All Japonica  1512 20.80% 79.20% 0.07% 0.00% NA
Aus  269 93.70% 6.30% 0.00% 0.00% NA
Indica I  595 96.80% 1.70% 1.51% 0.00% NA
Indica II  465 98.90% 0.60% 0.43% 0.00% NA
Indica III  913 99.20% 0.80% 0.00% 0.00% NA
Indica Intermediate  786 97.80% 1.80% 0.38% 0.00% NA
Temperate Japonica  767 11.00% 88.90% 0.13% 0.00% NA
Tropical Japonica  504 35.50% 64.50% 0.00% 0.00% NA
Japonica Intermediate  241 21.20% 78.80% 0.00% 0.00% NA
VI/Aromatic  96 64.60% 35.40% 0.00% 0.00% NA
Intermediate  90 53.30% 44.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819094093 T -> C LOC_Os08g30930.1 upstream_gene_variant ; 632.0bp to feature; MODIFIER silent_mutation Average:39.621; most accessible tissue: Zhenshan97 flower, score: 59.755 N N N N
vg0819094093 T -> C LOC_Os08g30910.1 downstream_gene_variant ; 4596.0bp to feature; MODIFIER silent_mutation Average:39.621; most accessible tissue: Zhenshan97 flower, score: 59.755 N N N N
vg0819094093 T -> C LOC_Os08g30910-LOC_Os08g30930 intergenic_region ; MODIFIER silent_mutation Average:39.621; most accessible tissue: Zhenshan97 flower, score: 59.755 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819094093 NA 3.20E-07 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093 NA 3.33E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093 NA 5.83E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093 NA 1.09E-06 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093 NA 2.36E-06 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093 NA 1.61E-07 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093 NA 3.84E-08 mr1420 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093 NA 7.06E-09 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093 NA 8.72E-06 mr1559 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093 NA 7.35E-08 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093 NA 9.71E-08 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093 NA 1.94E-12 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093 NA 2.58E-13 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093 NA 1.71E-07 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093 NA 1.10E-13 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093 NA 2.33E-06 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093 NA 6.48E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093 NA 1.32E-10 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093 NA 7.83E-06 mr1773 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093 NA 3.87E-09 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093 NA 8.59E-08 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093 NA 8.59E-08 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093 NA 5.11E-06 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093 NA 5.25E-07 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093 NA 1.13E-13 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093 NA 3.97E-11 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819094093 NA 1.44E-12 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251