\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819078104:

Variant ID: vg0819078104 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19078104
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, T: 0.04, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TGAGATTCTCAAAGTATTTGGAATTTTTCAAAACTTTTCTTATTTGAGGTGTCAGAAGCACAATTAATAGATTGATGAGAAAATTAAATTAAATTTTAGC[G/T]
AGTGGTAATAAAACAACATAATTGAGCTTTGGTTTTTAAGTGGATCTTTTTAGGTTTATTTTGGGTGAGATTGAGATTCTAAAACTATCTGAAATTTTTC

Reverse complement sequence

GAAAAATTTCAGATAGTTTTAGAATCTCAATCTCACCCAAAATAAACCTAAAAAGATCCACTTAAAAACCAAAGCTCAATTATGTTGTTTTATTACCACT[C/A]
GCTAAAATTTAATTTAATTTTCTCATCAATCTATTAATTGTGCTTCTGACACCTCAAATAAGAAAAGTTTTGAAAAATTCCAAATACTTTGAGAATCTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.90% 21.90% 0.19% 0.00% NA
All Indica  2759 74.50% 25.30% 0.22% 0.00% NA
All Japonica  1512 88.20% 11.80% 0.00% 0.00% NA
Aus  269 43.50% 55.40% 1.12% 0.00% NA
Indica I  595 96.10% 3.90% 0.00% 0.00% NA
Indica II  465 89.20% 9.90% 0.86% 0.00% NA
Indica III  913 64.80% 35.00% 0.11% 0.00% NA
Indica Intermediate  786 60.60% 39.30% 0.13% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 68.10% 31.90% 0.00% 0.00% NA
Japonica Intermediate  241 93.40% 6.60% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819078104 G -> T LOC_Os08g30900.1 downstream_gene_variant ; 1725.0bp to feature; MODIFIER silent_mutation Average:16.389; most accessible tissue: Zhenshan97 flag leaf, score: 24.95 N N N N
vg0819078104 G -> T LOC_Os08g30900.2 downstream_gene_variant ; 1725.0bp to feature; MODIFIER silent_mutation Average:16.389; most accessible tissue: Zhenshan97 flag leaf, score: 24.95 N N N N
vg0819078104 G -> T LOC_Os08g30900-LOC_Os08g30910 intergenic_region ; MODIFIER silent_mutation Average:16.389; most accessible tissue: Zhenshan97 flag leaf, score: 24.95 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819078104 NA 2.30E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819078104 NA 6.47E-09 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819078104 NA 5.84E-06 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819078104 3.87E-09 3.87E-09 mr1266 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819078104 NA 3.09E-06 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819078104 NA 2.58E-08 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819078104 NA 2.48E-07 mr1345 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819078104 NA 5.50E-07 mr1393 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819078104 NA 2.72E-06 mr1417 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819078104 NA 3.07E-08 mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819078104 NA 5.31E-06 mr1434 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819078104 NA 1.45E-08 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819078104 NA 1.74E-06 mr1467 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819078104 NA 4.04E-08 mr1485 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819078104 NA 5.64E-06 mr1544 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819078104 NA 2.59E-06 mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819078104 NA 2.36E-08 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819078104 NA 3.13E-08 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819078104 NA 1.36E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819078104 NA 1.56E-06 mr1700 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819078104 NA 8.52E-07 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819078104 NA 2.92E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819078104 1.72E-06 1.72E-06 mr1840 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819078104 NA 5.20E-08 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819078104 9.19E-06 9.19E-06 mr1873 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819078104 3.45E-06 6.33E-09 mr1963 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819078104 9.53E-06 9.53E-06 mr1984 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819078104 NA 9.33E-07 mr1988 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819078104 NA 2.47E-07 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819078104 NA 1.36E-06 mr1870_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251